View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9135_low_46 (Length: 247)

Name: NF9135_low_46
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9135_low_46
NF9135_low_46
[»] chr1 (1 HSPs)
chr1 (21-230)||(39090077-39090286)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 230
Target Start/End: Original strand, 39090077 - 39090286
Alignment:
21 aggtattgcttgtggatacacaaatccactacaaggaatagggaaatatgcaaggactattcacgagcctggttgtgcgaatgtggcatgcaatgatgat 120  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
39090077 aggtattgcttgtggatacacaagtccactacaaggaatagggaaatatgcaaggactattcacgagcccggttgtgcgaatgtggcatgcaatgatgat 39090176  T
121 aaacaatttgggtcggctctaaatgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagatagga 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39090177 aaacaatttgggtcggctctaaatgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagatagga 39090276  T
221 ctggtttact 230  Q
    ||||||||||    
39090277 ctggtttact 39090286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University