View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9136_high_4 (Length: 262)
Name: NF9136_high_4
Description: NF9136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9136_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 43 - 252
Target Start/End: Complemental strand, 22561675 - 22561466
Alignment:
| Q |
43 |
tcaaaataatcattgtgtgaacttcattggtcacattaaataataatttaatgtaatattgtaacccaatatctctaccacataaccaataattcttcca |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22561675 |
tcaaaataatcattgtgtgaacttcattggtcacattaaataataatttaatgtaatattgtaacccaatatctctaccacataaccaatcattcttcca |
22561576 |
T |
 |
| Q |
143 |
tctataaatactctttcttgcctctcatttttcctcccccttcaccttacatccttcttcatacaaccattgtactaagcttattgctatataaaccttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22561575 |
tctataaatactctttcttgcctctcatttttcctcccccttcaccttacatccttcttcatacaaccattgtactaagcttattgctatataaaccttt |
22561476 |
T |
 |
| Q |
243 |
ctctgcttct |
252 |
Q |
| |
|
|| ||||||| |
|
|
| T |
22561475 |
ctttgcttct |
22561466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University