View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9137_low_10 (Length: 219)
Name: NF9137_low_10
Description: NF9137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9137_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 6998370 - 6998558
Alignment:
| Q |
15 |
tggtgttcacaaaagaatggttatttgagttagatgatgcttttagagattctgtcaaatatggagatgattcaaagatgcatgttatgggaaagggaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6998370 |
tggtgttcacaaaagaatggttatttgagttggatgatacttttagagattctgtcaaacatggagatgattcaaagatgcatgttatgggaaagggaaa |
6998469 |
T |
|
| Q |
115 |
ttcaaagtggtaaaattcatattattcacgctggtgtatactacttgtctggattaagaaataatctgttgagca--tgggacagtttc |
201 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6998470 |
ttcaaagtggtaaaattcatattaatcacactggtgtatactacttgtctggattaagaaataatctgttgagcatgtgggacagtttc |
6998558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 111
Target Start/End: Complemental strand, 29944742 - 29944712
Alignment:
| Q |
81 |
atgattcaaagatgcatgttatgggaaaggg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29944742 |
atgattcaaagatgcatgttatgggaaaggg |
29944712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 111
Target Start/End: Complemental strand, 10783874 - 10783844
Alignment:
| Q |
81 |
atgattcaaagatgcatgttatgggaaaggg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10783874 |
atgattcaaagatgcatgttatgggaaaggg |
10783844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University