View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9138_low_24 (Length: 207)
Name: NF9138_low_24
Description: NF9138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9138_low_24 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 22792846 - 22792640
Alignment:
| Q |
1 |
cagcggagccagcttcgttggaaactgacggagaggtggtttctttgagtgccatccaggaagtggcgacggggacttcatcagagttgatggagtcacg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792846 |
cagcggagccaggttcgttggaaactgacggagaggtggtttctttgagtgccatccaggaagtggcgacggggacttcatcagagttgatggagtcacg |
22792747 |
T |
|
| Q |
101 |
cgtcggttgttgtggagtttcgttgggtcgtgagtttgttgtccaagtgttccatgaattgattggatttggattctcgttgttgttgtcgtcagatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792746 |
cgtcggttgttgtggagtttcgttgggtcgtgagtttgttgtccaagtgttccatgaattgattggatttggattctcgttgttgttgtcgtcagatgaa |
22792647 |
T |
|
| Q |
201 |
gatggat |
207 |
Q |
| |
|
||||||| |
|
|
| T |
22792646 |
gatggat |
22792640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University