View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9140_low_7 (Length: 235)
Name: NF9140_low_7
Description: NF9140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9140_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 3907689 - 3907910
Alignment:
| Q |
1 |
catctcctaatttataagttaatacatctgatattgatatttctgcacatatatttgcagctcgtggacctgaaattgtcgtcgaatggccaacaaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3907689 |
catctcctaatttataagttaatacatctgatattgatatttctgcacatatatttgcagctcgtggacctgaaattgtcgtcgaatggccaacaaggat |
3907788 |
T |
 |
| Q |
101 |
gaaaatagctattggaatcactaatggtctatcttgcttacacaaccaagagaatatagttcatgggaatctcacctcaagcaacatactattggatgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3907789 |
gaaaatagctattggaatcactaatggtctattttgcttacacaaccaagagaatatagttcatgggaatctcacctcaagcaacatactattggatgag |
3907888 |
T |
 |
| Q |
201 |
caaacaaatcctcacatcacag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3907889 |
caaacaaatcctcacatcacag |
3907910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 105
Target Start/End: Complemental strand, 4223087 - 4223017
Alignment:
| Q |
35 |
tgatatttctgcacatatatttgcagctcgtggacctgaaattgtcgtcgaatggccaacaaggatgaaaa |
105 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
4223087 |
tgatatttctgaacatatacttgcagctaacggacctgaaattatcgccgaatggaaaacaaggatgaaaa |
4223017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 218
Target Start/End: Complemental strand, 4223012 - 4222965
Alignment:
| Q |
171 |
ctcacctcaagcaacatactattggatgagcaaacaaatcctcacatc |
218 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
4223012 |
ctcacctcaagcgacatactattacatgagtaaacaaatcctcacatc |
4222965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University