View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9143_low_5 (Length: 250)
Name: NF9143_low_5
Description: NF9143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9143_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 24 - 220
Target Start/End: Complemental strand, 4137778 - 4137582
Alignment:
| Q |
24 |
tagtgaagatgacattcaaaaaggatgggctggtcttcaggtattttatttaaggttcatgataggatttcaatttgttataatttgctttaaggattta |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4137778 |
tagtgaagatgacattcaaaaaggatgggctggtcttcaggtattttattttaggttcatgataggatttcaatttgttataatttgctttaaggattta |
4137679 |
T |
 |
| Q |
124 |
ccaacatttttaaaacggtatgcaatcttgatttggttcgcgatactaaagattaaaaaaggtacgcgatctcatctagaccggaataccaagattt |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4137678 |
ccaacatttttaaaaaggtatgcaatcttgatttggttcgcgatactaaagattaaaaaaggtacgcgatctcatctagaccggaataccaagattt |
4137582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University