View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9144_low_4 (Length: 214)
Name: NF9144_low_4
Description: NF9144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9144_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 31800617 - 31800817
Alignment:
| Q |
9 |
tttggtgttaggattagattttggattcttatttttccattggattctgaaatgtttatgtgtatccttaatatgtttttgtctccataaataccttg-- |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31800617 |
tttggtgttaggattagattttggattcttatttttccattggattctgaaatgtttatgtgtatcgttaatatgtttttgtctccataaataccttgtg |
31800716 |
T |
 |
| Q |
107 |
------------tgtcaatccaacttatggtcaatttgattgtactattcttattttagttattgaatggagcttattttttaaaataaaatttggtatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31800717 |
ttgatctcaaaatgtcaatccaacttatggtcaatttgattgtactattcttattttagtatttgaatggagcttattttttaaaagaaaatttgttatt |
31800816 |
T |
 |
| Q |
195 |
g |
195 |
Q |
| |
|
| |
|
|
| T |
31800817 |
g |
31800817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University