View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9147_high_17 (Length: 233)
Name: NF9147_high_17
Description: NF9147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9147_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 44169154 - 44169370
Alignment:
| Q |
1 |
tcattaaaacgtggataatcgccaccctctctcccttcttactagtaaatagtatattttttcatcggtgatttatgacaagacaacgtgctaatgtctt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44169154 |
tcattaaaacgtggataatcaccaccctctctcccttcttactagtaaatagtatattttttcatcggtgatttatgacaagacaacatgctaatgtctt |
44169253 |
T |
 |
| Q |
101 |
ccattggaattaatttgagatcaatgctggccaacttttcnnnnnnntgcatgagaagtgtttgattgagaaagatgaaatgtaggaaccttaataaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44169254 |
tcattggaattaatttgagatcaatgctggccaacttttcaaaaaaatgcatgagaagtgtttgattgagaaacatgaaatgtaggaaccttaataaaat |
44169353 |
T |
 |
| Q |
201 |
tataaaagggacattgg |
217 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
44169354 |
tataaaagggacgttgg |
44169370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University