View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9147_low_23 (Length: 293)
Name: NF9147_low_23
Description: NF9147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9147_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 38 - 272
Target Start/End: Original strand, 34712796 - 34713030
Alignment:
| Q |
38 |
ttggtgttagtggtattttaacaaatctcaaggggaaatcaatgcaatttacacttaaatgattgaatcttaagtttgctaagttctggggggatgtttt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34712796 |
ttggtgttagtggtattttaacaaatctcaaggggaaatcaatgcaatttacacttaaatgattgaatcttaagtttgctaagttctggggtgatgtttt |
34712895 |
T |
 |
| Q |
138 |
aggcacacaaaaattcgtggggttttgcaaggcgtctggttggcttctactcgaggttgttgtttagatggtccaagnnnnnnnnnntcaagtgattgat |
237 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34712896 |
aggcacacaaaagttcgtggggttttgcaaggcgtctggttggcttctactcgaggttgttgtttagatggtccaagaaaaaaaaaatcaagtgattgat |
34712995 |
T |
 |
| Q |
238 |
ttcaattagttaacgatcataagaaaaaattaaac |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34712996 |
ttcaattagttaacgatcataagaaaaaattaaac |
34713030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University