View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9147_low_36 (Length: 240)
Name: NF9147_low_36
Description: NF9147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9147_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 54852600 - 54852395
Alignment:
| Q |
18 |
cccaccacaccaaacatacttgaatgtatattgctccacacttttgaaataaattctcagtcctatacttcctctcaagctgcccaaagatatgaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852600 |
cccaccacaccaaacatacttgaatgtatattgctccacacttttgaaataaattctcagtcctatacttcctctcaagctgcccaaagatatgaaattt |
54852501 |
T |
 |
| Q |
118 |
ggcctgaccaagatacgaaggaatggcacttccaaaaaataccacaaaataatctaagatatgagccaatactcgacaaaaactcccaatgctccccagc |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852500 |
ggcctgactaagatacgaaggaatggcacttccaaaaaataccacaaaataatctaagatatgagccaatactcgacaaaaactcccaatgctccccagc |
54852401 |
T |
 |
| Q |
218 |
tgcaac |
223 |
Q |
| |
|
|||||| |
|
|
| T |
54852400 |
tgcaac |
54852395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University