View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9147_low_43 (Length: 217)
Name: NF9147_low_43
Description: NF9147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9147_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 197
Target Start/End: Original strand, 51898830 - 51899017
Alignment:
| Q |
10 |
gaagcagagaaagatgaagttgttagatcagagagactcatcaccattgaagaagcactcaatcgccatatcagtttctgtaaagagttcagatcatcat |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51898830 |
gaagcagtgaaagatgaagttgttagatcagagagactcatcaccattgaagaagcactcaatcgccatatcagtttctgtaaagagttcagatcatcat |
51898929 |
T |
 |
| Q |
110 |
catccactgttttgaataaaacagaacaccctataattctcatgagtcgaagaattcgtcggagtttggattgccctagaccgcctct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51898930 |
catccactgttttgaataaaacagaacaccctatcattctcatgagtcgaagaattcgtcggagtttggattgccctagaccgcctct |
51899017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 10 - 110
Target Start/End: Original strand, 51887272 - 51887372
Alignment:
| Q |
10 |
gaagcagagaaagatgaagttgttagatcagagagactcatcaccattgaagaagcactcaatcgccatatcagtttctgtaaagagttcagatcatcat |
109 |
Q |
| |
|
||||||| ||||||||| |||||||||||| |||||| ||||||||||||||||| | ||||| || |||| ||||| ||||||||| |||||||||| |
|
|
| T |
51887272 |
gaagcagtgaaagatgaggttgttagatcaaagagacgtatcaccattgaagaagctttgaatcgacacatcaatttctataaagagtttagatcatcat |
51887371 |
T |
 |
| Q |
110 |
c |
110 |
Q |
| |
|
| |
|
|
| T |
51887372 |
c |
51887372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University