View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9148_low_16 (Length: 355)
Name: NF9148_low_16
Description: NF9148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9148_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 7598686 - 7598863
Alignment:
| Q |
1 |
agatttcctccaccgcctttgacgccaaggtcacagcagaattgtaaggcaagatcatcatgtctgccgccccttcagccactttcgattgctcgccgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7598686 |
agatttcctccaccgcctttgacgccaaggtcacagcagaattgtaaggcaagatcatcatgtctgccgccccttcagccactttcgattgctcgccgaa |
7598785 |
T |
 |
| Q |
101 |
gtttggatgagtggccgaaagcgagctccgatgatatcggggagtggccacaaccacctattactcctggtgggagag |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7598786 |
gtttggatgagtggccgaaagcgagctccgatgatatcggggagtggccacaaccacctattactcctggtgggagag |
7598863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 229 - 323
Target Start/End: Original strand, 7598914 - 7599008
Alignment:
| Q |
229 |
ggtgaaaggttgaaacttgatttgtctacaattcagcagaataataatcctgatagtagaaataatggtggacttgtgaagagagataaaattgc |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7598914 |
ggtgaaaggttgaaacttgatttgtctacaattcagcagaataataatcctgatagtagaaataacggtggacttgtgaagagagataaaattgc |
7599008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University