View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9148_low_3 (Length: 722)
Name: NF9148_low_3
Description: NF9148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9148_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 351; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 326 - 708
Target Start/End: Complemental strand, 11782787 - 11782405
Alignment:
| Q |
326 |
gacgggggaacttcccaagattgatgcaaatcttattggttggttctctaagaatgcattattggagtttcgggagagaatggaggggacatatctattg |
425 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11782787 |
gacgggggaacttcccaagagtgatgcaaatcttattggttggttctctaagaatgcattattagagtttcgggagagaatggaggggacatatctattg |
11782688 |
T |
|
| Q |
426 |
tccgccattattagggatatgtttttgtgaggaagagaccaatgtaattgggtatttatattagtgatctcaaatctagaagacgtgattttaatatcaa |
525 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11782687 |
tccaccattattagggatatgtttttgtgaggaagagaccaatataattgggtatttatattagtgatctcaaatctggaagacgtgattttaatatcaa |
11782588 |
T |
|
| Q |
526 |
attactcatattttaatctcataaaattgaatttgtaatttaatatcaagagaacaatctagatattattgactataaaaattacataattatattttta |
625 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11782587 |
attactcatattttaatctcataaaattgaatttataatttaatatcaagagaacaatctagatattattgactataaaaattacataattattttttta |
11782488 |
T |
|
| Q |
626 |
acatcaaatttggatttccctttttaccctttctaggttagtcatgtcccaacctaagtctatccctttcatcaagtgatgtc |
708 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11782487 |
acatcaaatttggatttccctttttaccctttttaggttagtcatgtcccaacctaagtctatccctttcatcaagtgatgtc |
11782405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 183; E-Value: 1e-98
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 11783098 - 11782896
Alignment:
| Q |
18 |
ccaatagggacctcgataagaaatggttccattaggatgtcatcggtattttcattagtaacgatggatataggtttaggcttattcttagcacctttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
11783098 |
ccaatagggacctcgataagaaatggttccattaggatgtcatcggtattttcattagtaacgatggatacaggtttaggcttattcttagcgcctttgg |
11782999 |
T |
|
| Q |
118 |
gtctacctctggttttcttggaggaggatgcggtatggtcctccgttagatcttgaggtagatcaacagacctagtgcataagggttgtgctagtgttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11782998 |
gtctacctctggttttcttggaggaggatgcggtatggtcctccgttagatcttgaggtagatcaacagacctatcgcataagggttgtgccagtgttaa |
11782899 |
T |
|
| Q |
218 |
tgt |
220 |
Q |
| |
|
||| |
|
|
| T |
11782898 |
tgt |
11782896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University