View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9149_high_1 (Length: 727)
Name: NF9149_high_1
Description: NF9149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9149_high_1 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0276 (1 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 336; Significance: 0; HSPs: 153)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 352 - 722
Target Start/End: Complemental strand, 10557571 - 10557200
Alignment:
| Q |
352 |
cagtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10557571 |
cagtcttgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaagttg |
10557472 |
T |
 |
| Q |
452 |
aatttctatccactatactacttgaccacagaaaa-gtaaacacttgcatatgactgtaaatgttatagtactaatactaaccataaagactttagctcc |
550 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10557471 |
aatttctagccactatactacttgaccacagaaaaagtaaacacttgcataggactgtaaatgttatagtactaatgctaaccataaagactttagctcc |
10557372 |
T |
 |
| Q |
551 |
agagttaagagcattgatgatcatctttctctcaacagggccagtaatctcaactttcctatcagaaacagctggtggaacaggtgcacagatccaatct |
650 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557371 |
agagttaagagcattgatgatcatctttctctcaacagggccagtaatctcaactttcctatcagaaacagctggtggaacaggtgcacagatccaatct |
10557272 |
T |
 |
| Q |
651 |
ccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctctgcttct |
722 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10557271 |
ccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttct |
10557200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 10557903 - 10557636
Alignment:
| Q |
20 |
cttgagaacgccgaaaagttgagtgattgtggtagaagtagagaccaaaatcaacaagacaaccggttgcaggttcaccatcaatcagaatatgagcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557903 |
cttgagaacgccgaaaagttgagtgattgtggtagaagtagagaccaaaatcaacaagacaaccggttgcaggttcaccatcaatcagaatatgagcttc |
10557804 |
T |
 |
| Q |
120 |
cggtaaatgccaacctcttggtcgcacaaaaagctttgctatctcatcattcagcttgtaaactttgtttctacctttgtcatggaatgttatggtccca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557803 |
cggtaaatgccaacctcttggtcgcacaaaaagctttgctatctcatcattcagcttgtaaactttgtttctacctttgtcatggaatgttatggtccca |
10557704 |
T |
 |
| Q |
220 |
gccacagcatccttcaagttcacttgacctttcataagattctcccagcttggagaaagtgcatcctc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557703 |
gccacagcatccttcaagttcacttgacctttcataagattctcccagcttggagaaagtgcatcctc |
10557636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 8402404 - 8402283
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc |
457 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||| ||||| |||| | ||| || | |||||||||| |||||||| | ||||||||| |
|
|
| T |
8402404 |
cgtgagcttagctcaattggtagggacattgcataatatatgcagcggccggggttcgtaccccgaattccccacttattcaccttaagaggtgaatttc |
8402305 |
T |
 |
| Q |
458 |
tatccactatactacttgacca |
479 |
Q |
| |
|
|| |||||| ||||||||||| |
|
|
| T |
8402304 |
tagccactaggctacttgacca |
8402283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 360 - 479
Target Start/End: Original strand, 39164982 - 39165100
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta |
459 |
Q |
| |
|
||||||||||||| |||| || || ||||||||| ||||||| |||||| |||| |||| |||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
39164982 |
tgagcttagctcagttggtagagacattgcataacatatgcaagggccg-ggttcgaacaccggacaccccacttattcaccttaagaggtgaatttcta |
39165080 |
T |
 |
| Q |
460 |
tccactatactacttgacca |
479 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
39165081 |
gccactaggctacttgacca |
39165100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 1588802 - 1588886
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| ||| |||||| ||||||||||| ||||||| |||| |||||| |
|
|
| T |
1588802 |
tatatgcaggggccggggttcgaacctcggacaccccacttattcactttaaaa-gtgaatttctagccactatgctacctgacca |
1588886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 387 - 466
Target Start/End: Complemental strand, 43508515 - 43508437
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| |||||||||||||||| |||||| ||| ||||||||||| |||||| |
|
|
| T |
43508515 |
tgcataatatatgtaggggccggggtttgaaccccggacaccccacttattcacctt-aaaggtgaatttctagccacta |
43508437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 481013 - 481095
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
481013 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaggggccgcggttcgaaccccggacaccccacttctccac |
481095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 2800017 - 2800138
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
2800017 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
2800115 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
2800116 |
ctagccactaggctacctgacca |
2800138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 34894375 - 34894453
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
34894375 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
34894453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42877036 - 42877117
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||| |||||||||||||||||| ||||| || ||||||||||| ||||| |
|
|
| T |
42877036 |
cgtgagcttagctcaattggtagggacattgcataatttatgcaggggccgtggttcgaacc-cgaacaccccacttctccac |
42877117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 10292350 - 10292469
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||| | | || |||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
10292350 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccacttattcactttaaaa-gtgaattt |
10292448 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| |||||| ||||| |||| |
|
|
| T |
10292449 |
ctagccactagactacctgac |
10292469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 23178959 - 23178883
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |
|
|
| T |
23178959 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
23178883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 355 - 451
Target Start/End: Original strand, 41458294 - 41458390
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||| |||| |||| || ||||||||||| ||||||||||||| | | || ||||||||||||| |||||| ||||| || ||||||| |
|
|
| T |
41458294 |
tctcgtgagcttaactcagttggtagggatattgcatattatatgcaggggctgggtttcgaacctcggacactccacttctccacatttaaatgtg |
41458390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 7764004 - 7763925
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| || ||||||||||| ||||||||||||||| | ||||||| |||||||||||||| ||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcaggggccgggatttgaactccggacaccccacttctccac |
7763925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 356 - 439
Target Start/End: Complemental strand, 10200751 - 10200668
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
10200751 |
ctcgtgagcttagctcagttggtagagatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcca |
10200668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 2787149 - 2787067
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
2787149 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
2787067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2792781 - 2792863
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
2792781 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccac |
2792863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 5328631 - 5328553
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
5328631 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccac |
5328553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10736942 - 10736860
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10736942 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
10736860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 14876670 - 14876588
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||||||| |||||||||| |||| |||| ||||||||||||| |||||| ||||| |
|
|
| T |
14876670 |
cgtgagcttagctcagttggtagggaaattgcatattatatgcaggagccggggttcgaacctcggacactccacttctccac |
14876588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 26022249 - 26022331
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
26022249 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccac |
26022331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 357 - 451
Target Start/End: Complemental strand, 26192785 - 26192691
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||| ||| |||| || ||||||||||| ||||||||| || || |||| ||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
26192785 |
tcgtgagcttagttcagttggtagggatattgcatattatatgcagaggtcggggttcgaaccccggacaccccacttctccatattaaaatgtg |
26192691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29716862 - 29716944
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
29716862 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
29716944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34413064 - 34413146
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
34413064 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
34413146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 10083165 - 10083246
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| |||| |
|
|
| T |
10083165 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctcca |
10083246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 27077164 - 27077083
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||| | |||||||||||||| ||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccggacaccccacttctccac |
27077083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 40362050 - 40362131
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| || | || ||||||||||| |||||||||||| || |||| ||||||||||||| |||||| |||| |
|
|
| T |
40362050 |
cgtgagcttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacctcggacactccacttctcca |
40362131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 12770372 - 12770452
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| ||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
12770372 |
tgagcttagctcagttgatagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac |
12770452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 22274677 - 22274597
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccccacttctccac |
22274597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 35939489 - 35939565
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
35939489 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcaaaccgtggacaccccactt |
35939565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 15042425 - 15042343
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||| ||||| |||||| ||||||||| |
|
|
| T |
15042425 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaa-ttctaaccactacgctacttgac |
15042343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 33570489 - 33570407
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
|||||||| ||| || |||| |||||||||||||||||||||| ||||||| || ||||| ||||| |||||| |||||||||| |
|
|
| T |
33570489 |
tatatgcatgggtcggggttcgaacctcggacaccccacttattcaccttataaggtgaa-ttctagccactaaactacttgac |
33570407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 94579 - 94497
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| ||| ||||| ||||||| |||||| ||||| |
|
|
| T |
94579 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggacactccacttctccac |
94497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6280482 - 6280564
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6280482 |
cgtgagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
6280564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6659291 - 6659373
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6659291 |
cgtgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
6659373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6739693 - 6739775
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6739693 |
cgtgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
6739775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 7816409 - 7816487
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||||||||||| |||||| ||||| |
|
|
| T |
7816409 |
agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaacctcggacactccacttctccac |
7816487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 8034480 - 8034398
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| ||||||||||||||| |||| |||| | |||||||||||| ||||| |
|
|
| T |
8034480 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaacaccagacaccccacttctccac |
8034398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8265270 - 8265352
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
8265270 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaaccccggacactccacttctccac |
8265352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10568087 - 10568169
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| || ||||||||| | |||||||||| |||||||||||||| ||||| |
|
|
| T |
10568087 |
cgtgagtttagctcagttggtagggatattgcatattaaatgcaggggaaggggtttgaaccccggacaccccacttctccac |
10568169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 11231424 - 11231498
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||| ||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
11231424 |
tgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
11231498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11875888 - 11875970
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
11875888 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac |
11875970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11890895 - 11890977
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
11890895 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac |
11890977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17027948 - 17027867
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||| || |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
17027948 |
cgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaacc-cggacaccccacttctccac |
17027867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17072631 - 17072549
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| || |||| || |||||||||| ||||||||||||||| |||| ||||| || ||||||||||| ||||| |
|
|
| T |
17072631 |
cgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccac |
17072549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17558384 - 17558303
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||| || |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
17558384 |
cgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaacc-cggacaccccacttctccac |
17558303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17575640 - 17575722
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| || |||| || |||||||||| ||||||||||||||| |||| ||||| || ||||||||||| ||||| |
|
|
| T |
17575640 |
cgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccac |
17575722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17698524 - 17698606
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
17698524 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac |
17698606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 28909467 - 28909549
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| || ||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
28909467 |
cgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaaccccggacactccacttctccac |
28909549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31712551 - 31712633
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||| ||| |||||| ||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
31712551 |
cgtgagtttagctcacttggcagggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccac |
31712633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 37717365 - 37717447
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
37717365 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
37717447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43656038 - 43656120
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||||| || |||| |||||||||||| |||||| ||||| |
|
|
| T |
43656038 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggtcggggttcgaacctcggacattccacttctccac |
43656120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43856450 - 43856368
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || |||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
43856450 |
cgtgagcttaactcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
43856368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 458
Target Start/End: Original strand, 2696531 - 2696631
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| || |||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
2696531 |
cgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
2696629 |
T |
 |
| Q |
457 |
ct |
458 |
Q |
| |
|
|| |
|
|
| T |
2696630 |
ct |
2696631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 4798601 - 4798517
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |||||| || ||||| ||||| |||||| ||||| |||||| |
|
|
| T |
4798601 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgtaaggtgaa-ttctagccactagactacctgacca |
4798517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 16432196 - 16432115
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||| |||| |||||||| |||||| |||| |
|
|
| T |
16432196 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacatcggacactccacttctcca |
16432115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 25890471 - 25890390
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| | |||| || || |||||||||| |||||| |||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
25890471 |
gtgagcttagcttagttggtagggacattgcataatttatgcaagggccggggttcgaaccccggacaccccacttctccac |
25890390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 387 - 451
Target Start/End: Complemental strand, 2908130 - 2908066
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| ||||||||||||| ||| | |||||||||| |
|
|
| T |
2908130 |
tgcataatatatgcaggggccggggttcgaaccctggacaccccacttctccgcattaaaatgtg |
2908066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 7194266 - 7194346
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| ||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
7194346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 28420494 - 28420410
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||| ||||||| || |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
28420494 |
ctcgtgagcttagctcagttggtaggaatattgcatattatatgctggagccggggttcgaaccccggacactccacttctccac |
28420410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 364 - 440
Target Start/End: Original strand, 40393326 - 40393402
Alignment:
| Q |
364 |
cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| || |||| ||||| || ||||||| ||| ||||| |
|
|
| T |
40393326 |
cttagctcaattggcaggaatattgcataatttatgcaggggtcggggttcgaaccccgaacacccctcttctccac |
40393402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 359 - 419
Target Start/End: Original strand, 42006781 - 42006841
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccgtggttcgaacc |
42006841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 13647518 - 13647443
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| |||||||||| | ||||||| ||||| ||||||| |||||| ||||| |
|
|
| T |
13647518 |
ttagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccac |
13647443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 13747943 - 13747868
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| |||||||||| | ||||||| ||||| ||||||| |||||| ||||| |
|
|
| T |
13747943 |
ttagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccac |
13747868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 15856575 - 15856492
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| |||| || || |||||||||| ||| ||||| ||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
15856575 |
tcgtgagcttaactcagttggtagggacattgcataatttatacagggaccggggttcaaacctcggacaccccacttctccac |
15856492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Original strand, 23239159 - 23239241
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
|||||| ||||| || |||||||||| |||||||||||||||| ||||||| || |||||||| || |||||| ||||| |||| |
|
|
| T |
23239159 |
tatatgtaggggtcggggtttgaaccccggacaccccacttattcaccttataaagtgaattt-taaccactagactacctgac |
23239241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 24480886 - 24480807
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||| |||| || ||||||| ||| ||||||||||||| | |||| |||||| ||||||||||||| ||||| |
|
|
| T |
24480886 |
gagcttatctcagttggtagagatattgtatattatatgcaggggctggggttcgaaccttggacaccccacttctccac |
24480807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 34266017 - 34266096
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| || ||||||||||| |||||||||| | | |||| ||||||||||||| |||||| ||||| |
|
|
| T |
34266017 |
gagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaacctcggacactccacttctccac |
34266096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 37708692 - 37708775
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||| ||||||||||||||| |||| ||||| |||||| ||||||| ||||| |
|
|
| T |
37708692 |
cgtgagcttagctcaattggtagggataagtgcattttatatgcaggggccggggttcgaaccccggacatcccacttctccac |
37708775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 458
Target Start/End: Complemental strand, 41454922 - 41454824
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttct |
458 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
41454922 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctt-taatgtgaatttct |
41454824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 369 - 440
Target Start/End: Original strand, 44444557 - 44444628
Alignment:
| Q |
369 |
ctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||| |||| || ||||||||||| ||||||||||||| | |||| ||||| |||||||||||||| ||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacaccccacttctccac |
44444628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 257541 - 257623
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
257541 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccac |
257623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 658379 - 658297
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
658379 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccac |
658297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 844115 - 844033
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
844115 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccac |
844033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 1503914 - 1503987
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||| ||||||| ||||||| ||| |||||||||| |||| |||| ||||| | |||||||||||| |
|
|
| T |
1503914 |
tgagcttagctcagttggcagggatattg-atattatatgcaggagccggggttcgaaccccagacaccccactt |
1503987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 5570896 - 5570978
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | |||||||||| |||||||||||| || ||| ||||| |||||||||||||| ||||| |
|
|
| T |
5570896 |
cgtgagcttagctcagttggttgggatattgcatgttatatgcaggggtcggagttcgaaccccggacaccccacttctccac |
5570978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 447
Target Start/End: Original strand, 7314731 - 7314821
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||| || |||||||||||| || | | ||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |
|
|
| T |
7314731 |
cgtgagcataactcaattggcagggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaa |
7314821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 7797136 - 7797214
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
7797136 |
agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
7797214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 13059245 - 13059163
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || | |||||||| ||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
13059245 |
cgtgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccac |
13059163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 16449127 - 16449209
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
16449127 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccagacactccacttctccac |
16449209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 22717795 - 22717869
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||| ||| || | |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
22717795 |
tgagcttagctcagttgaaaggaacattgcataatttatgcaggggccgaggttcgaaccccggacaccccactt |
22717869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 23858199 - 23858249
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg |
408 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |
|
|
| T |
23858199 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccg |
23858249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 424
Target Start/End: Original strand, 24458319 - 24458385
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcgga |
424 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| ||||||||||||||| |||| ||||| |||| |
|
|
| T |
24458319 |
cgtgagcttagctcagttggaagggatattgtatattatatgcaggggccggggttcgaaccccgga |
24458385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 364 - 434
Target Start/End: Complemental strand, 25812271 - 25812201
Alignment:
| Q |
364 |
cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||| |||| ||| |||| ||||| | |||||||||||| |
|
|
| T |
25812271 |
cttagctcaattggcagggacattgcataatttatggagggtccggggttcgaaccccagacaccccactt |
25812201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31451025 - 31450943
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| |||| ||||||| |||||| ||||| |
|
|
| T |
31451025 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccac |
31450943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36035247 - 36035165
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || | ||||| |||||||||||| || |||| |||||||||||||||||||| ||||| |
|
|
| T |
36035247 |
cgtgagcttagctcaattggtagaataaatgcattttatatgcaggggtcggggttcgaacctcggacaccccacttctccac |
36035165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 37290948 - 37291006
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
37290948 |
gatattgcatattatatgcaggggccggcgttcgaaccccggacaccccacttctccac |
37291006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 38219636 - 38219554
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
38219636 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
38219554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42880950 - 42881032
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||| ||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
42880950 |
cgtgagcttaactcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccac |
42881032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43085291 - 43085209
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| ||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
43085291 |
cgtgagcttagctcagttgggagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
43085209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43284034 - 43283952
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||| || ||||| |
|
|
| T |
43284034 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccac |
43283952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 472
Target Start/End: Complemental strand, 44070428 - 44070351
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac |
472 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||| |||||| ||||||| || ||||| ||||| |||||| ||||| |
|
|
| T |
44070428 |
tatatgtaggggccgcggttcgaacctcggacaccctacttattcaccttataaggtgaa-ttctagccactaaactac |
44070351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 5326238 - 5326157
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||| ||||| ||| ||||| ||||||| |||||| |||| |
|
|
| T |
5326238 |
cgtgagcttagctcagttggtagagatattgcattttatatgcagaggccggtgttcgaaccccggacactccacttctcca |
5326157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 7453354 - 7453435
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||| |||||||| ||| || |||||||||| |||||| |||||||| |||| ||||| |||||||||||||| |||| |
|
|
| T |
7453354 |
cgtgagtttagctcagctggtagggatattgcattttatatgtaggggccggggttcgaaccccggacaccccacttctcca |
7453435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 8969098 - 8969179
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| | |||| || |||||||||| |||||||||| || | |||| ||||||||||||| |||||| ||||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatgcaggagctggggttcgaacctcggacactccacttctccac |
8969179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 13105122 - 13105175
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||||| |||||||||||| ||||| |
|
|
| T |
13105122 |
tgcataatatatgcaagggccggggttcgaacctcagacaccccacttctccac |
13105175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 382 - 443
Target Start/End: Complemental strand, 19957393 - 19957332
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
19957393 |
gataatgcatattatatgcaggggacgaggttcgaaccccggacaccccacttattcacctt |
19957332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 23435300 - 23435219
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| ||||| |
|
|
| T |
23435300 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccac |
23435219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 355 - 440
Target Start/End: Original strand, 38344048 - 38344133
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| |||| || ||||||||||| |||||||||| || | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
38344048 |
tctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccagacactccacttctccac |
38344133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 427
Target Start/End: Complemental strand, 38955262 - 38955193
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
|||||||||| |||| |||| || |||||| |||| ||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
38955262 |
cgtgagcttaactcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacac |
38955193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 447
Target Start/End: Original strand, 39362267 - 39362356
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||| || | ||| ||||| | |||||||||||| ||||| |||||| |
|
|
| T |
39362267 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagaggttggagttcgaaccccagacaccccacttctccacattaaaa |
39362356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 41616434 - 41616341
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||| || |||| |||| || ||||||| ||| ||||||||||||||| |||| ||||| |||| || |||||| ||||| ||| |||||| |
|
|
| T |
41616434 |
cgtgagcataactcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccggatactccacttctccacattataatgtg |
41616341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 407
Target Start/End: Original strand, 41689884 - 41689933
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggcc |
407 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||||| |
|
|
| T |
41689884 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggcc |
41689933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 1937312 - 1937388
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| |
|
|
| T |
1937312 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
1937388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 4615744 - 4615668
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||| |||| ||| |||| || ||||||||||| |||||||||| || |||||||||||||||||| |||||| |
|
|
| T |
4615744 |
cgtgagtttagttcagttggtagggatattgcatattatatgcaggagcttgggtttgaacctcggacactccactt |
4615668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 392 - 436
Target Start/End: Original strand, 8350469 - 8350513
Alignment:
| Q |
392 |
aatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8350469 |
aatatatgcaggggccggagttcgaacctcggacaccccacttat |
8350513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 8698648 - 8698572
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||||| | |||| ||| | |||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccggacaccccactt |
8698572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 396 - 444
Target Start/End: Original strand, 11822999 - 11823047
Alignment:
| Q |
396 |
tatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
11822999 |
tatgtaggggccggggtttgaaccccggacaccccacttattcacctta |
11823047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 357 - 405
Target Start/End: Complemental strand, 22437859 - 22437811
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcagggg |
405 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||||| |||||||||| |
|
|
| T |
22437859 |
tcgtgagcttagctcagttggtagggatattgcataatttatgcagggg |
22437811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 23339964 - 23339888
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||| |||| |||| || ||||||| ||| |||||| |||||||| |||| ||||| ||||||||||||| |
|
|
| T |
23339964 |
cgtgagcttaactcagttggtagagatattgtatattatatgtaggggccggggttcgaaccctggacaccccactt |
23339888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 439
Target Start/End: Original strand, 30300332 - 30300412
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||||||||| |||| || || |||||||||||||||||||||| |||| ||||| |||| |||| |||| |||| |
|
|
| T |
30300332 |
gtgagcttagctcagttggaagagacgatgcataatatatgcaggggccggggttcgaaccccggaaaccctacttctcca |
30300412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 366 - 477
Target Start/End: Complemental strand, 35301252 - 35301141
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac |
464 |
Q |
| |
|
||||||| ||||||| || | ||||| || ||||||||||| || |||| |||| ||||||||| |||||| ||| |||||| ||||||||||| |||| |
|
|
| T |
35301252 |
tagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttattcactttaaaa-gtgaatttctagccac |
35301154 |
T |
 |
| Q |
465 |
tatactacttgac |
477 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
35301153 |
tagactacctgac |
35301141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Complemental strand, 12293 - 12246
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg |
405 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| |
|
|
| T |
12293 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
12246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 363 - 434
Target Start/End: Complemental strand, 7109353 - 7109283
Alignment:
| Q |
363 |
gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||| |||| || ||||||||||| ||||||||||||||| || | ||||| || ||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatgcaggggccgaggctcgaacc-cgaacaccccactt |
7109283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 446
Target Start/End: Original strand, 14583228 - 14583287
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa |
446 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||| || ||||||||||| ||||| ||||| |
|
|
| T |
14583228 |
tgcataatatatgcaggggctggggttcgaaccacgaacaccccacttctccacattaaa |
14583287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 36359778 - 36359696
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||||||||||||| ||| ||| | |||||||||||||||| ||||||| || ||||| ||||| |||||| ||||| |||| |
|
|
| T |
36359778 |
tatatgcaggggccggagttcgaatcccggacaccccacttattcaccttataaggtgaa-ttctagccactagactacctgac |
36359696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 38745347 - 38745264
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcata-atatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||| ||||| |||| ||||| ||||||||||||| ||||| |
|
|
| T |
38745347 |
cgtgagcttagctcagttggtagggatattgcatatttatatgcatgggccagggttcgaacccaggacaccccacttctccac |
38745264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 1337159 - 1337101
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
1337159 |
gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
1337101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 5683760 - 5683838
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||||||| | |||| ||||| | ||||||| |||| ||||| |
|
|
| T |
5683760 |
agcttagctcaattggtaggaatattgcatattatatgcaggggttggggttcgaaccccagacaccctacttctccac |
5683838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 6942575 - 6942517
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6942575 |
gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
6942517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 9370194 - 9370252
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||||||||||| | |||| ||||| |||||||| ||||||||||| |
|
|
| T |
9370194 |
gatattgcatattatatgcaggggtcagggttcgaaccccggacacctcacttatccac |
9370252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10573103 - 10573185
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||||| | |||| ||||| || |||| |||||| ||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccgaacactccacttctccac |
10573185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11872068 - 11872150
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| ||| | |||| || |||||| ||| ||||||||||||||| |||||||||| || |||| |||||| ||||| |
|
|
| T |
11872068 |
cgtgagctttgcttagttggtagagatattacattttatatgcaggggccggggtttgaaccccgaacactccacttctccac |
11872150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 13406602 - 13406684
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| ||| ||||| |||||| |||||| ||||| |
|
|
| T |
13406602 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggagttcgaaccctggacactccacttctccac |
13406684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 17980317 - 17980359
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
17980317 |
tatatgcaggggccggggttcgaaccccggacaccccacttat |
17980359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 28378847 - 28378932
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggaca-ccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||| | |||| ||||| |||||| |||||||||| ||||||| || ||||| ||||| |||||| ||||| |||||| |
|
|
| T |
28378847 |
tatatgcaggggctgaggttcgaaccccggacacccccacttattcaccttataaggtgaa-ttctaaccactaaactacctgacca |
28378932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29514628 - 29514710
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||||||| || | |||| |||| ||||||| |||||| ||||| |
|
|
| T |
29514628 |
cgtgagcttagctcagttggtagggatattgtatattatatgcaggagctggggttcaaaccccggacactccacttctccac |
29514710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 30972885 - 30972804
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||| || |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
30972885 |
cgtgagcttagctcagttggtagggatattgcatattatatgccggagccg-ggttcgaatcccggacactccacttctccac |
30972804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 31406787 - 31406841
Alignment:
| Q |
386 |
ttgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||||||||| ||| ||||| ||||| |
|
|
| T |
31406787 |
ttgcataatttatgcaggggccggggttcgaacctcggataccacacttctccac |
31406841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 466
Target Start/End: Complemental strand, 31802966 - 31802863
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttct |
458 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||| ||||| ||| |||| |||| ||||||||| |||||||||| |||||||| | |||||||| | |
|
|
| T |
31802966 |
gtgagcatagctcaattggcagggatgttgca----atatgtaggagccggggttcaaacctcggattccccacttattcaccttaagaggtgaatttat |
31802871 |
T |
 |
| Q |
459 |
atccacta |
466 |
Q |
| |
|
| |||||| |
|
|
| T |
31802870 |
agccacta |
31802863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 404
Target Start/End: Complemental strand, 32719675 - 32719629
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggg |
404 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||| |
|
|
| T |
32719675 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggg |
32719629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34158725 - 34158643
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || | || |||||| ||||| |
|
|
| T |
34158725 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcatactccacttctccac |
34158643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 34873124 - 34873170
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| || |||| |||||||||||||||||||| ||||| |
|
|
| T |
34873124 |
tatatgcaggggtcggggttcgaacctcggacaccccacttctccac |
34873170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 361 - 439
Target Start/End: Complemental strand, 37524272 - 37524194
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||||||| |||| || ||||||||||| ||||||||| ||||| |||| |||||| |||| |||||| |||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgcagaggccgaggttcaaacctcatacactccacttctcca |
37524194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 38283126 - 38283208
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||| |||| ||||||| || ||| ||||| ||||||||||||| |||| ||||| | |||||||||||| ||||| |
|
|
| T |
38283126 |
cgtgagtttaactcagttggcagggacattatataatttatgcaggggccggggttcgaaccccagacaccccacttctccac |
38283208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 40740551 - 40740608
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||||||| || | | |||||||||||||||||||| ||||| |
|
|
| T |
40740551 |
gatattgcatattatatgcaggggc-gtaggtcgaacctcggacaccccacttctccac |
40740608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43186855 - 43186937
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| ||| | || ||||| ||||||| |||||| ||||| |
|
|
| T |
43186855 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccaggattcgaaccccggacactccacttctccac |
43186937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 431
Target Start/End: Complemental strand, 2294167 - 2294094
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca |
431 |
Q |
| |
|
|||||| |||||||||||| || |||||| |||| |||||||||||| || |||| ||||| | ||||||||| |
|
|
| T |
2294167 |
cgtgagtttagctcaattgatagggatattacatattatatgcaggggtcggggttcgaaccccagacacccca |
2294094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 3912207 - 3912150
Alignment:
| Q |
383 |
atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||||| | ||||||||||||| ||||| |
|
|
| T |
3912207 |
atattgcatattatatgcagaggccgaggtttgaatcctggacaccccacttctccac |
3912150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 5184947 - 5184886
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||| | |||| ||||| ||||||||||||||| ||||||| || ||||||| |
|
|
| T |
5184947 |
tatatgcaggggctggggttcgaaccctggacaccccacttattcaccttataaggtgaatt |
5184886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 5332919 - 5333000
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || |||||| ||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
5332919 |
gtgagcttagctcagttggtagagatattatatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
5333000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 8862193 - 8862112
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| | |||| || ||||||||||| |||||||||||| | |||| |||| ||||||| |||||| ||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacactccacttttccac |
8862112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 9524992 - 9525053
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| | ||||||| |||||| ||||||| || ||||||| |
|
|
| T |
9524992 |
tatatgcaggggccggggttcgaaccccagacaccctacttattcaccttataaggtgaatt |
9525053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 10030415 - 10030496
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| | |||| |||||| ||||| |
|
|
| T |
10030415 |
gtgagtttagctcagttggtagagatattgcatattatatgcaggtgccggggttcgaaccctgaacactccacttctccac |
10030496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 10199802 - 10199741
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| | ||||||||||||| ||||||| || ||||||| |
|
|
| T |
10199802 |
tatatgcaggggccggggttcgaaccccaaacaccccacttattcaccttataaggtgaatt |
10199741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 13702412 - 13702351
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||||| |||||| ||||||| ||||||| || ||||||| |
|
|
| T |
13702412 |
tatatgcaggggtcggggttcgaacctcagacacctcacttattcaccttataaggtgaatt |
13702351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 14011098 - 14011045
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| ||||||||| || ||||||| |
|
|
| T |
14011098 |
tatatgcaggggccggagttcgaacctcggacatcccacttattcatcttaaaa |
14011045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 17467313 - 17467361
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
17467313 |
tatatgcaggggccg-ggttcgaaccccggacaccccacttattcacctt |
17467361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 17987509 - 17987448
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||| |||| ||||||| || ||||||| |
|
|
| T |
17987509 |
tatatgcaggggccggagttcgaaccccggacaccccaattattcaccttataaggtgaatt |
17987448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 24608543 - 24608482
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| | ||||||| |||||| ||||||| || ||||||| |
|
|
| T |
24608543 |
tatatgcaggggccggggttcgaaccccagacaccctacttattcaccttataaggtgaatt |
24608482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 30942659 - 30942598
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| || ||||||||||||| |||||| || ||||||| |
|
|
| T |
30942659 |
tatatgcaggggccggggttcgaaccccgaacaccccacttatttaccttataaggtgaatt |
30942598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 362 - 407
Target Start/End: Original strand, 37838583 - 37838628
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggcc |
407 |
Q |
| |
|
|||||||||||| ||| || ||||||||||| |||||||||||||| |
|
|
| T |
37838583 |
agcttagctcaaatggtagggatattgcatattatatgcaggggcc |
37838628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 38620408 - 38620327
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||| |||||||||| |||| | || ||||| || |||| |||||| ||||| |
|
|
| T |
38620408 |
gtgagcttagctcagttggtagggatattgtatattatatgcaggagccgggattcgaaccccgaacactccacttctccac |
38620327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 2e-23; HSPs: 167)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 36763431 - 36763553
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaatt |
455 |
Q |
| |
|
||||||||| ||||| |||| || || |||||||||||||||||||||||| ||||||||| |||||||||||||||| || ||| |||| ||||||| |
|
|
| T |
36763431 |
cgtgagcttggctcagttggtagggacattgcataatatatgcaggggccggagtttgaacc-cggacaccccacttattcatctttaaaaaggtgaatt |
36763529 |
T |
 |
| Q |
456 |
tctatccactatactacttgacca |
479 |
Q |
| |
|
|||| |||||| |||||||||||| |
|
|
| T |
36763530 |
tctagccactagactacttgacca |
36763553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 9624981 - 9625102
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
9624981 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
9625079 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| ||||| |||||| |
|
|
| T |
9625080 |
ctagccactagactacctgacca |
9625102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24303392 - 24303474
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
24303392 |
cgtgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac |
24303474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 361 - 451
Target Start/End: Original strand, 43280073 - 43280163
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||||||| |||| ||| | |||||||||||||| ||||| || ||||||| |
|
|
| T |
43280073 |
gagcttagctcaattggcagggacattgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccacatttaaatgtg |
43280163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 17602746 - 17602662
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
17602746 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgtaggggccgaggttcgaaccccggacaccccacttctccac |
17602662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 360 - 451
Target Start/End: Complemental strand, 49443489 - 49443398
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||| ||||||||||||| ||| ||||| |||||||||||||| ||||| || ||||||| |
|
|
| T |
49443489 |
tgagtttagctcaattggcagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaaatgtg |
49443398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19222654 - 19222572
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| ||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
19222654 |
cgtgagcttaactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac |
19222572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 27183778 - 27183657
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
27183778 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
27183680 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
27183679 |
ctagccactaggctacctgacca |
27183657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 32256622 - 32256540
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
32256622 |
cgtgagcttagctcagttggtagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac |
32256540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34102679 - 34102597
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
34102679 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
34102597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 39719937 - 39720019
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
39719937 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
39720019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 41936471 - 41936393
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
41936471 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
41936393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 466
Target Start/End: Original strand, 24559387 - 24559495
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| || |||| |||| |||||||| ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
24559387 |
cgtgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
24559485 |
T |
 |
| Q |
457 |
ctatccacta |
466 |
Q |
| |
|
||| |||||| |
|
|
| T |
24559486 |
ctaaccacta |
24559495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 46845039 - 46844946
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |||||||||| || ||| ||||| ||||||||| |||| ||||| || ||||||| |
|
|
| T |
46845039 |
cgtgagcttagctcaattggcagggacattgcataatttatgcaggggtcggagttcgaaccccggacaccctacttctccacatttaaatgtg |
46844946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 11436504 - 11436588
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||| |||| |||| || ||||||||||| |||||||||||||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
11436504 |
ctcgtgaacttaactcagttggtagggatattgcatattatatgcaggggccgtggttcgaaccctggacaccccacttctccac |
11436588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 30779637 - 30779553
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| ||||||||||||| ||||| |
|
|
| T |
30779637 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacaccccacttctccac |
30779553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 477
Target Start/End: Complemental strand, 36331823 - 36331704
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||||||||||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| ||||| || |
|
|
| T |
36331823 |
cgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaaagtgaa-tt |
36331725 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| |||||| ||||| |||| |
|
|
| T |
36331724 |
ctagccactagactacctgac |
36331704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 53163596 - 53163672
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||||||||||| |
|
|
| T |
53163596 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccactt |
53163672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 15975155 - 15975230
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||||||||||| |||||| |
|
|
| T |
15975155 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacctcggacactccactt |
15975230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 360 - 479
Target Start/End: Original strand, 45118644 - 45118763
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta |
459 |
Q |
| |
|
||||||||||||| |||| || || ||||||| |||||||||||||||| |||| ||||| ||| |||||||||| ||| |||| | ||||||||||| |
|
|
| T |
45118644 |
tgagcttagctcagttggtagggacattgcattatatatgcaggggccggggttcgaacccgggattccccacttattcactttaagaggtgaatttcta |
45118743 |
T |
 |
| Q |
460 |
tccactatactacttgacca |
479 |
Q |
| |
|
|||||| ||||| ||||| |
|
|
| T |
45118744 |
gccactaggctactcgacca |
45118763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4139002 - 4139084
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
4139002 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
4139084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25954862 - 25954780
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||||||||||||| | ||||| ||||| ||||||||||||||| |||| ||||||||||||||||| || ||||| |
|
|
| T |
25954862 |
cgtgaggttagctcaattggtatggatatcgcatattatatgcaggggccgaggttcgaacctcggacaccccatttctccac |
25954780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 29373517 - 29373435
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| | ||||||||||| ||||||||||||||| |||| ||||||| |||||||||||| ||||| |
|
|
| T |
29373517 |
cgtgagcttaactcagttggtaaggatattgcatattatatgcaggggccggggttcgaacctcagacaccccacttctccac |
29373435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31327786 - 31327704
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
31327786 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
31327704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 37800679 - 37800597
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
37800679 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
37800597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40933899 - 40933817
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
40933899 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
40933817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 44652050 - 44651968
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| ||||||||| ||||| |
|
|
| T |
44652050 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggataccccacttctccac |
44651968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 47098734 - 47098816
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
47098734 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccac |
47098816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 50496882 - 50496800
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
50496882 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
50496800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 53432804 - 53432723
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
53432804 |
gtgagtttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
53432723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 25279129 - 25279045
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| | |||| || ||||||| ||| |||||| |||||||| | |||||||| |||||||||||||| ||||| |
|
|
| T |
25279129 |
ctcgtgagcttagcttagttggtagggatattgtatattatatgtaggggccgggatttgaaccccggacaccccacttctccac |
25279045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 32776214 - 32776289
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||| ||||| |
|
|
| T |
32776214 |
gtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcactt |
32776289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2522928 - 2523010
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||| | || | |||||||||| ||||||| |||||| ||||| |
|
|
| T |
2522928 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaagagctggggtttgaaccccggacactccacttctccac |
2523010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6920031 - 6919949
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| || |||| |||||| ||||| |
|
|
| T |
6920031 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccac |
6919949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9176654 - 9176572
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||| | |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
9176654 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactccacttctccac |
9176572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10176971 - 10176889
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10176971 |
cgtgaggttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
10176889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 366 - 440
Target Start/End: Complemental strand, 10952365 - 10952291
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| || ||| |||||| |||||||||||| |||| ||||| | |||||||||||||||||| |
|
|
| T |
10952365 |
tagctcaattggcagggacattacataatttatgcaggggcctgggttcgaacccccgacaccccacttatccac |
10952291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 17440025 - 17439963
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| ||||||| || |||||||| |
|
|
| T |
17440025 |
tatatgcaggggccggtgtttgaacctcggataccccacttattcaccttataaggtgaattt |
17439963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 18194340 - 18194422
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
18194340 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
18194422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22472382 - 22472300
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||| | |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
22472382 |
cgtgagcttaactcagttggtagagatattgcatattatatgcaagagccggggttcgaaccccggacaccccacttctccac |
22472300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22501999 - 22501917
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
22501999 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac |
22501917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 385 - 451
Target Start/End: Complemental strand, 23653257 - 23653191
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||| || ||||| ||||||||||| |||||||||| |
|
|
| T |
23653257 |
attgcataatatatgcaggggtcggggttcgaaccccgaacacctcacttatccacattaaaatgtg |
23653191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31327569 - 31327487
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| ||||| |
|
|
| T |
31327569 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggaaactccacttctccac |
31327487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33706795 - 33706713
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||| |||||||| | |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
33706795 |
cgtgagcttagctcaattggtagggatattacatattatatgcaagagccggggttcgaaccccggacactccacttctccac |
33706713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34898835 - 34898753
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
34898835 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccac |
34898753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 37488528 - 37488446
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
37488528 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
37488446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39966142 - 39966060
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| | |||| ||||||| ||||| |||||| ||||| |
|
|
| T |
39966142 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggttgaggttcgaacctcagacactccacttctccac |
39966060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40548305 - 40548387
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||| || ||||| |
|
|
| T |
40548305 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccac |
40548387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 45701346 - 45701428
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| ||||| |
|
|
| T |
45701346 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccac |
45701428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 48739812 - 48739730
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
48739812 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccac |
48739730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 50234126 - 50234208
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
50234126 |
cgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
50234208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52974121 - 52974039
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
52974121 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
52974039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 54769898 - 54769816
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| |||||||||| |||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
54769898 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggtgccggagttcgaaccacggacaccccacttctccac |
54769816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 458
Target Start/End: Original strand, 166786 - 166886
Alignment:
| Q |
358 |
cgtgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| |||| | | |||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||||| |||||| ||| |||||||| |
|
|
| T |
166786 |
cgtgagcttagctcacttggtaagggataatgcataatttatgcaggggccggggttcgaaccccagacacctcacttattcacctttaaa-gtgaattt |
166884 |
T |
 |
| Q |
457 |
ct |
458 |
Q |
| |
|
|| |
|
|
| T |
166885 |
ct |
166886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 466
Target Start/End: Original strand, 14868683 - 14868791
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| || ||||||||||||| ||| |||||| ||||| || |
|
|
| T |
14868683 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcactttaaaa-gtgaaatt |
14868781 |
T |
 |
| Q |
457 |
ctatccacta |
466 |
Q |
| |
|
||| |||||| |
|
|
| T |
14868782 |
ctagccacta |
14868791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 24537862 - 24537923
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
24537862 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
24537923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 431
Target Start/End: Complemental strand, 28550387 - 28550314
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca |
431 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
28550387 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaagttcgaactccggacacccca |
28550314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 46328984 - 46328923
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
46328984 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
46328923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 50724402 - 50724463
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
50724402 |
tatatgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaagtgaatt |
50724463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 50788446 - 50788385
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
50788446 |
tatatgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaagtgaatt |
50788385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 382 - 434
Target Start/End: Complemental strand, 5641658 - 5641606
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
5641658 |
gatattgcatattatatgcaggggccggggttcgaacctcggacacctcactt |
5641606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 6488128 - 6488208
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
6488128 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggctagggttcgaaccccagacactccacttctccac |
6488208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 10959131 - 10959250
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||| |||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
10959131 |
cgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
10959229 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| ||||| ||||| |||| |
|
|
| T |
10959230 |
ctagtcactagactacctgac |
10959250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 374 - 446
Target Start/End: Original strand, 17003820 - 17003892
Alignment:
| Q |
374 |
ttggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa |
446 |
Q |
| |
|
||||||| || ||||||||||||||||||| ||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
17003820 |
ttggcagggacattgcataatatatgcaggatccgaggtttgaacaccggacaccccacttattaaccttaaa |
17003892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 17218492 - 17218572
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||| |||||| |||| |||| ||||||| |||||| ||||| |
|
|
| T |
17218492 |
tgagcttagctcagttggtagggatattgcatattatatgcaagggccggggttcaaaccccggacactccacttctccac |
17218572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 362 - 434
Target Start/End: Original strand, 26942759 - 26942831
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||| |||| || ||||||||||| |||||||||||||| |||| ||||| | |||||||||||| |
|
|
| T |
26942759 |
agcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccgcagacaccccactt |
26942831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 29559740 - 29559660
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| |||| || ||||||||||| |||||| || || || ||||||||| ||||||||||||||| ||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatgtagaggtcggggtttgaacttcggacaccccacttctccac |
29559660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 31586951 - 31587031
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||||||| || ||| ||| | |||||||||||||| ||||| |
|
|
| T |
31586951 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaatcccggacaccccacttctccac |
31587031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Original strand, 38949683 - 38949758
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| || ||||||||||| ||||| |
|
|
| T |
38949683 |
ttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccgaacaccccacttctccac |
38949758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 472
Target Start/End: Original strand, 3955304 - 3955420
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcagggg--ccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaat |
454 |
Q |
| |
|
||||||| ||||||||||| ||| || | ||||| || ||||||||||| ||| |||| ||||| |||||||||||||||| ||| |||||| ||||| |
|
|
| T |
3955304 |
cgtgagcatagctcaattgacagggacaatgcattattatatgcaggggggccggggttcgaaccccggacaccccacttattcactttaaaaagtgaa- |
3955402 |
T |
 |
| Q |
455 |
ttctatccactatactac |
472 |
Q |
| |
|
||||| |||||| ||||| |
|
|
| T |
3955403 |
ttctagccactaaactac |
3955420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4860163 - 4860245
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | |||||||||| ||||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
4860163 |
cgtgagcttagctcagttggtacggatattgcattttatatgcaggggctgaggttcgaaccccagacaccccacttctccac |
4860245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7269957 - 7270039
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||| ||||||| |||||| ||||| |
|
|
| T |
7269957 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccac |
7270039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7920322 - 7920404
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||| | |||| |||| ||||| ||||||| | |||| ||||| |
|
|
| T |
7920322 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactcaacttctccac |
7920404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 419 - 477
Target Start/End: Complemental strand, 12100174 - 12100116
Alignment:
| Q |
419 |
ctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
|||||| || ||| |||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
12100174 |
ctcggatactccatttattcaccttaaaaagtgaatttctagccactatactacttgac |
12100116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 14795113 - 14795195
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || || ||||||||||||||||||| ||| |||| |||| |||||||||||||| ||||| |
|
|
| T |
14795113 |
cgtgagcttagcttagttggtagtgacattgcataatatatgcaggtgccagggttcaaaccccggacaccccacttctccac |
14795195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17608387 - 17608305
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| || | |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
17608387 |
cgtgagcttaacttagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccac |
17608305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 28689740 - 28689658
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
28689740 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
28689658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 29098694 - 29098816
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg-aattt |
456 |
Q |
| |
|
||||| |||| |||| |||| || ||||||| ||| |||||||||||| || |||| ||||| ||||||||||| || |||| || || |||| || || |
|
|
| T |
29098694 |
cgtgaacttaactcagttggtagagatattgtatattatatgcaggggtcggggttcgaaccccggacaccccatttctccatatttaattgtgtaagtt |
29098793 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||||||||||| |
|
|
| T |
29098794 |
ctagccactagactacttgacca |
29098816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31529026 - 31528944
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
31529026 |
cgtgagcttagctcagttggtagggatattgaatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
31528944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32144586 - 32144668
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || | ||||||||| |||||||||| |||| |||| ||||| ||||||||||| || ||||| |
|
|
| T |
32144586 |
cgtgagcttagcttagttggtaggggtattgcatattatatgcaggagccggggttcgaaccccggacaccccatttctccac |
32144668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33607007 - 33606926
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| |||||||||||||| || |||||||||| |||||||||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
33607007 |
cgtgaacttagctcaattggtagggatattgcattttatatgcaggggtcg-ggttcgaaccccggacactccacttctccac |
33606926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 366 - 440
Target Start/End: Original strand, 49447148 - 49447222
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
49447148 |
tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
49447222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 49593919 - 49594017
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta |
459 |
Q |
| |
|
|||||||||| |||||| || || ||||||| ||||||||| || | ||||||||||| ||| ||||||||| | |||||||| | ||||||||||| |
|
|
| T |
49593919 |
gagcttagctgaattggtagggacattgcattatatatgcaaggattggggtttgaaccttggataccccacttgttcaccttaagaggtgaatttcta |
49594017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52309178 - 52309096
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| | |||||||||||| ||||| |
|
|
| T |
52309178 |
cgtgagcttaactcagttggtagggatattgcatactatatgcaggagtcggggttcgaaccccagacaccccacttctccac |
52309096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52410309 - 52410227
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| | || ||||| | ||||| |||||| ||||| |
|
|
| T |
52410309 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggattcgaaccccagacactccacttctccac |
52410227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 52945897 - 52945978
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
52945897 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacc-cgtacactccacttctccac |
52945978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 53347358 - 53347276
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||| | | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
53347358 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggactggggttcgaaccccagacactccacttctccac |
53347276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 4227812 - 4227731
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||| |||||||| |||| || || |||||||||| |||||||||| || |||| |||| |||||||||||||| |||| |
|
|
| T |
4227812 |
cgtgagtttagctcagttggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaccccacttctcca |
4227731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 5636866 - 5636785
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||| | |||| ||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactcgacttctccac |
5636785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 9684998 - 9685079
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||| ||||||||||||||| || |||||||||| ||||||||||| | |||| ||| | || |||| |||||| |||| |
|
|
| T |
9684998 |
cgtgagcatagctcaattggcagggacattgcataatttatgcaggggctggggttcgaatcccgaacactccacttctcca |
9685079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 19999869 - 19999930
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| |
|
|
| T |
19999869 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc |
19999930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 429
Target Start/End: Original strand, 20489819 - 20489888
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc |
429 |
Q |
| |
|
||||||||||||| |||| || | ||||||||| ||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcaggggccggagttcgaaccccggacaccc |
20489888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 24130594 - 24130643
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||||||||||| || |||||||||| |||||||||||||||| |||||| |
|
|
| T |
24130594 |
tatatgcaggggacggggtttgaaccccggacaccccacttattcacctt |
24130643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 25884027 - 25883974
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
25884027 |
tgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctccac |
25883974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 27394542 - 27394591
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||||| |||||| |
|
|
| T |
27394542 |
tatatgcaggggctggggtttgaaccccggacaccccacttattcacctt |
27394591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 33206792 - 33206853
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||| | |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
33206792 |
tatatgcaggggctggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
33206853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 43566856 - 43566795
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||||| |||||||||||||| ||||||| || ||||||| |
|
|
| T |
43566856 |
tatatgcaggggtcggggttcgaacctcagacaccccacttattcaccttataaggtgaatt |
43566795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 44764722 - 44764804
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| |||| || || |||||||||| ||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
44764722 |
ctcgtgagcttagctcagttggtagggacattgcataatttatgcaggggc--gggttcgaaccccggacactccacttctccac |
44764804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 46795997 - 46795936
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
46795997 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacc |
46795936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 48251575 - 48251656
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||| |||||||||| |||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
48251575 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttagaaccctggacactccacttctccac |
48251656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 52030156 - 52030240
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||| |||||| ||| |||||| |||||||| || |||||| |||| |||||| |
|
|
| T |
52030156 |
tatatgcaggggccggggttcgaaccccggacaccctacttattcactttaaaa-gtgaatttttagccactaggctacctgacca |
52030240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 53577958 - 53578039
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||| ||||||| |||||||| | |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatgcaagagccggggttcgaaccccggacactccacttctccac |
53578039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 439
Target Start/End: Complemental strand, 3614147 - 3614067
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||| |||| || || |||||||||| ||||||||||| | |||| ||||| | |||||||||||| |||| |
|
|
| T |
3614147 |
gtgagcttagctctgttggtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctcca |
3614067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 362 - 434
Target Start/End: Complemental strand, 4640544 - 4640472
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||||||| |||| |||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacctcgaacactccactt |
4640472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 396 - 479
Target Start/End: Complemental strand, 24136810 - 24136726
Alignment:
| Q |
396 |
tatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
|||||||||||| || | ||||| |||||||||||||||| ||| || |||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
24136810 |
tatgcaggggccagggatcgaaccccggacaccccacttattcactttaaaaaggtgaatttctagccactaggctacttgacca |
24136726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 432
Target Start/End: Original strand, 28951720 - 28951792
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||| ||||||||||| | |||| ||||| | |||||||||| |
|
|
| T |
28951720 |
tgagcttaactcaattggcaaggacattgcataatttatgcaggggctggggttcgaaccccagacaccccac |
28951792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 443
Target Start/End: Original strand, 40160732 - 40160819
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||| ||||||||||||||| || || |||| | |||||| ||||| | |||||||||| |||||||||||||||| |||||| |
|
|
| T |
40160732 |
ctcgtgagcatagctcaattggcagggacat-gcattgttatatgccggggctggggtttgaaccccggacaccccacttattcacctt |
40160819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 48546175 - 48546251
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| |||| || |||| ||||| |||||||| ||||| |
|
|
| T |
48546175 |
cgtgagcttagctcagttggtagtgatattgcatattatatgtagggatcggggttcgaaccccggacacctcactt |
48546251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 51155158 - 51155078
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || |||||| ||| |||||| |||||| | |||| ||||||| |||||||||||| ||||| |
|
|
| T |
51155158 |
tgagcttagctcagttggtaggaatattggatattatatgtaggggctggggttcgaacctccgacaccccacttctccac |
51155078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 393 - 477
Target Start/End: Complemental strand, 54983766 - 54983683
Alignment:
| Q |
393 |
atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||||||||||| || |||| ||||| ||||||||||| |||| ||||||| || ||||| ||||| |||||| ||||| |||| |
|
|
| T |
54983766 |
atatatgcaggggtcggggttcgaaccccggacaccccatttattcaccttataaggtgaa-ttctagccactaaactacctgac |
54983683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 356 - 419
Target Start/End: Original strand, 2368936 - 2368999
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||||| ||||||||||||| | |||| ||||| |
|
|
| T |
2368936 |
ctcgtgagcttagctcagttgttagggatattgcatattatatgcaggggctggggttcgaacc |
2368999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 396 - 455
Target Start/End: Original strand, 2732700 - 2732759
Alignment:
| Q |
396 |
tatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||| | |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
2732700 |
tatgcaggggcaggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
2732759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 3993767 - 3993681
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaat-gtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| |||| ||| || ||||| ||||| ||||| |||||| ||||||||||| |
|
|
| T |
3993767 |
tatatgcaggggccgcggtttgaaccccggacaccccatttatgcactttgaaaatggtgaa-ttctaaccactaggctacttgacca |
3993681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Original strand, 8125641 - 8125696
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt |
413 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||| ||| |||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggtt |
8125696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 420
Target Start/End: Complemental strand, 11250660 - 11250597
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacct |
420 |
Q |
| |
|
|||||| ||||||||| |||| || ||||||||||| ||||||||||| ||| |||| |||||| |
|
|
| T |
11250660 |
tcgtgaacttagctcagttggtagggatattgcatattatatgcagggtccggggttcgaacct |
11250597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 42108243 - 42108168
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| ||||||||| ||||| | || ||||| ||||| |||||||| ||||| |
|
|
| T |
42108243 |
ttagctcagttggtagggatattgcatattatatgcagaggccgggtttcgaaccccggacgccccacttctccac |
42108168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 46336571 - 46336488
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||| | ||||||||||||||||| || |||| ||||| || ||||||||||| ||||| |
|
|
| T |
46336571 |
cgtgagcttagctcagttggtagggataaatacataatatatgcaggggtcggggttcgaaccccgaacaccccacttttccac |
46336488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 52984013 - 52984088
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| | |||||| ||| || |||| ||||| ||||||| |||||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatgcaagggtcggggttcgaaccccggacactccactt |
52984088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 54408611 - 54408536
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| ||||||| || |||||||||| ||||||| || || |||| ||||| ||||||||||| || ||||| |
|
|
| T |
54408611 |
ttagctcatttggcagggacattgcataatttatgcagaggtcggggttcgaaccccggacaccccatttttccac |
54408536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 882391 - 882473
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| | |||| |||||| ||||| |
|
|
| T |
882391 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctgaacactccacttttccac |
882473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3748670 - 3748588
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||||||||| | |||| ||||| |||||| | ||||| ||||| |
|
|
| T |
3748670 |
cgtgagcttagctcagttggtagggatattgtatattatatgcaggggttggggttcgaaccccggacatctcacttctccac |
3748588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3894546 - 3894628
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| | ||||||||||| |||||||||| |||| |||| |||| ||||||| |||||| ||||| |
|
|
| T |
3894546 |
cgtgagcttagttcagttggtatggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccac |
3894628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 4010078 - 4009992
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||| |||| |||||| ||||||| | ||||| |||||| ||||||||||| |
|
|
| T |
4010078 |
tatatgcaggggccgcagtttgaaccccgaacaccccatttattcaccttgaaaatgttgaattctaaccactaggctacttgacca |
4009992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 4237047 - 4236974
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||||||||| ||| |||| || || |||||||||| |||||||||| || |||| ||||| |||||||||||| |
|
|
| T |
4237047 |
cgtgagcttagttcagttggtagggacattgcataatttatgcagggg-cggggttcgaaccccggacaccccac |
4236974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4880171 - 4880253
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | |||||||||| ||||||||| ||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
4880171 |
cgtgagcttagctcagttggtacggatattgcattttatatgcagtggctgaggttcgaaccccagacaccccacttctccac |
4880253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 447
Target Start/End: Original strand, 7517942 - 7518028
Alignment:
| Q |
362 |
agcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||| |||| | | ||||||||| ||| | |||||| |||| |||| ||||| || |||||||||||||||| ||||||| |
|
|
| T |
7517942 |
agcttagctcatttggtaagggatattgcacaatttgtgcaggagccgcggttcgaaccccgaacaccccacttatccatcttaaaa |
7518028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10482921 - 10482839
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| |||||||||| || | |||| |||| ||||||| |||||| ||||| |
|
|
| T |
10482921 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccac |
10482839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17728994 - 17729075
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||| || |||| ||||| |||||| |||||| ||||| |
|
|
| T |
17728994 |
cgtgagcttagctcaattgattg-gatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac |
17729075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19030223 - 19030304
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||| || |||| ||||| |||||| |||||| ||||| |
|
|
| T |
19030223 |
cgtgagcttagctcaattgattg-gatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac |
19030304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19996520 - 19996438
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| | | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
19996520 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccggacactccacttctccac |
19996438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Complemental strand, 24751320 - 24751278
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
24751320 |
tatatgcaggggccggggttcgaaccccggacaccccacttat |
24751278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 25833829 - 25833906
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| | ||||||||||| |||||||||| | || |||| |||||||| |||| |||||||||||| |
|
|
| T |
25833829 |
agcttagctcagttggtaaagatattgcatattatatgcaggag-cggggttcgaacctcgaacactccacttatccac |
25833906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 385 - 451
Target Start/End: Original strand, 26880206 - 26880272
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||| |||||||||| || |||| |||| || |||||||||||| ||||| || ||||||| |
|
|
| T |
26880206 |
attgcataatttatgcaggggtcggggttcgaacttcagacaccccacttctccacatttaaatgtg |
26880272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 27329964 - 27329918
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
27329964 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccac |
27329918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 436
Target Start/End: Original strand, 32421371 - 32421425
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
|||| ||||||||||||||||||| || |||| |||||||| || |||||||||| |
|
|
| T |
32421371 |
gataatgcataatatatgcaggggtcggggttcgaacctcgaactccccacttat |
32421425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32828443 - 32828525
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||| || | |||||||| | | ||||| |||||| ||||| |
|
|
| T |
32828443 |
cgtgagcttagctcggttggtagggatattgcatattatatgcaggagctgaggtttgaatcccagacactccacttttccac |
32828525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33225416 - 33225334
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| |||||||||| |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
33225416 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccac |
33225334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 36476357 - 36476478
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| || ||||||||||| || | ||||| || |||||||||||||| ||| ||||| || ||||||||||||| ||| |||||| ||||||| |
|
|
| T |
36476357 |
cgtgagcataactcaattggcacggacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttattcactttaaaa-gtgaattc |
36476455 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
36476456 |
ctagccactaggctacctgacca |
36476478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40192158 - 40192240
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||| || || ||| ||| | ||||||| |||||| ||||| |
|
|
| T |
40192158 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcggtgttcgaatcccggacactccacttctccac |
40192240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 44625257 - 44625211
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
44625257 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccac |
44625211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45551877 - 45551795
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| |||||| |||||||| | || ||||| ||||||| |||||| ||||| |
|
|
| T |
45551877 |
cgtgagcttagctcagttggtagggatatcgcattttatatgtaggggccgggattcgaaccccggacactccacttctccac |
45551795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 472
Target Start/End: Original strand, 49146119 - 49146196
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac |
472 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||||| ||| ||| || ||||| ||||| |||||| ||||| |
|
|
| T |
49146119 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcactttataaggtgaa-ttctagccactaaactac |
49146196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 466
Target Start/End: Complemental strand, 49750475 - 49750365
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac-cttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||| ||||||||||||| | |||| ||| | |||||||||||| | ||| |||||||||||| |
|
|
| T |
49750475 |
tcgtgagcttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaattccagacaccccacttcttcacatttaaaatgtgaagc |
49750376 |
T |
 |
| Q |
456 |
tctatccacta |
466 |
Q |
| |
|
|||| |||||| |
|
|
| T |
49750375 |
tctagccacta |
49750365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 356 - 434
Target Start/End: Original strand, 50659590 - 50659668
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||||| |||| |||| || ||||| ||| ||||||||||||||| |||| ||||| ||||||| |||||| |
|
|
| T |
50659590 |
ctcgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccactt |
50659668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 429
Target Start/End: Original strand, 51772892 - 51772962
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc |
429 |
Q |
| |
|
||||||||| || | |||| || ||||||||||| |||||||||||| || |||| ||||||| ||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcagacaccc |
51772962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 51879133 - 51879179
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
51879133 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccac |
51879179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 53467984 - 53468033
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||| ||||||| |
|
|
| T |
53467984 |
tatatgcaggggcgg-ggttcgaacctcggacaccccacttattcacctta |
53468033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 54349904 - 54349826
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||| |||| |||||| || ||||||||||| |||||||||||| || ||| ||||||||||||| ||||| ||||| |
|
|
| T |
54349904 |
agctcagcttaattggtagggatattgcatattatatgcaggggtcggagttcaaacctcggacacctcacttctccac |
54349826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 3973337 - 3973386
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| |||| |||||| |
|
|
| T |
3973337 |
tatatgcaggggccgcgatttgaaccccggacaccccatttattcacctt |
3973386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 3996539 - 3996490
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| | |||||||| ||||||||||| |||| |||||| |
|
|
| T |
3996539 |
tatatgcaggggccgcgatttgaaccccggacaccccatttattcacctt |
3996490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 6951850 - 6951798
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
|||||||||||| || | ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6951850 |
tatatgcaggggtcg-gatttgaacctcggacaccgcacttattcaccttaaaa |
6951798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 14417903 - 14417964
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||| | ||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
14417903 |
tatatgcaggggctggagttcgaaccccggacaccccacttattcaccttataaggtgaatt |
14417964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 16886585 - 16886666
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || || |||||||| | ||| ||||||||| | || |||||| |||||||||||| ||||| |
|
|
| T |
16886585 |
gtgagcttagctcagttggtagggacattgcatattgtatacaggggccgggattcaaacctcagacaccccacttttccac |
16886666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 19550508 - 19550553
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |
|
|
| T |
19550508 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19550553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 25938998 - 25938937
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| |
|
|
| T |
25938998 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc |
25938937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 27983858 - 27983939
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||| |||||||||||| || |||||||||| | ||||| ||| || ||||| |
|
|
| T |
27983858 |
gtgagcttagctcagttggtagaaatattgcattttatatgcaggggtcggggtttgaaccccagacactccaattctccac |
27983939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 436
Target Start/End: Complemental strand, 29645890 - 29645845
Alignment:
| Q |
391 |
taatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
|||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
29645890 |
taatatgtgcaggggccggggttcgaaccccggacaccccacttat |
29645845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 410 - 447
Target Start/End: Original strand, 31680783 - 31680820
Alignment:
| Q |
410 |
ggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
31680783 |
ggtttgaacttcggacaccccacttattcaccttaaaa |
31680820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 31698568 - 31698629
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||| |||| |||| |||||||| ||||||||||||| || |||| || ||||||| |
|
|
| T |
31698568 |
tatatgcaggagccggggttcgaacctcgaacaccccacttattcatcttataaggtgaatt |
31698629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 32508854 - 32508793
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| || ||||||||||||| ||||||| || ||||||| |
|
|
| T |
32508854 |
tatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt |
32508793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 42271073 - 42271012
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||||| |||||| ||||||| || ||||||| |
|
|
| T |
42271073 |
tatatgcaggggccggggttcgaactccggacaccctacttattcaccttataaggtgaatt |
42271012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 43774220 - 43774281
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| | |||||||||||||| ||||||| || ||||||| |
|
|
| T |
43774220 |
tatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
43774281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 357 - 434
Target Start/End: Original strand, 45647304 - 45647381
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||| ||||||||||| |||| || || |||| |||| ||||||||||| || |||| ||||| |||||||| ||||| |
|
|
| T |
45647304 |
tcgttagcttagctcagttggtagggacattgtataaaatatgcagggggcggggttcgaaccccggacacctcactt |
45647381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 45871019 - 45871088
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
|||||| |||||||| |||| || ||||||| ||| |||||||||||| || |||| ||||| ||||||| |
|
|
| T |
45871019 |
cgtgagtttagctcagttggtagggatattgtatattatatgcaggggtcggggttcgaaccccggacac |
45871088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 366 - 451
Target Start/End: Complemental strand, 46817411 - 46817326
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||| ||| || |||||||||| |||| || || | |||||||||| || ||||||||||| ||||| || ||||||| |
|
|
| T |
46817411 |
tagctcaattgacagagacattgcataatttatgtagaggttggggtttgaaccccgaacaccccacttctccacatttaaatgtg |
46817326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Complemental strand, 50536900 - 50536855
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |
|
|
| T |
50536900 |
cgtgagcttagctcagttggtagagatattgcatattatatgcagg |
50536855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 436
Target Start/End: Original strand, 54295238 - 54295283
Alignment:
| Q |
391 |
taatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
54295238 |
taatatatgtaggggccggggttcgaacctcggacactccacttat |
54295283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 3e-22; HSPs: 162)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42044114 - 42044032
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||| ||||||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
42044114 |
cgtgagcttagctcagttggcagagacattgcataatttatgcaggggccgaggtttgaaccccggacaccccacttctccac |
42044032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 358 - 450
Target Start/End: Complemental strand, 11294906 - 11294814
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| || |||||| |
|
|
| T |
11294906 |
cgtgagcttaactcaattggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaatgt |
11294814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 9692960 - 9693081
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| |||| ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
9692960 |
cgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
9693058 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
9693059 |
ctagccactaggctacctgacca |
9693081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22788742 - 22788660
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||||||| | |||||||||||||| ||||| |
|
|
| T |
22788742 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggtttgaatcccggacaccccacttctccac |
22788660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 42411551 - 42411429
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | |||||||| ||||||||||| || |||| ||||| |||||||||||||||| || |||||| |||||||| |
|
|
| T |
42411551 |
cgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatttactttaaaaagtgaattt |
42411452 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| ||||||||||| |
|
|
| T |
42411451 |
ctagccactaggctacttgacca |
42411429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 51890799 - 51890881
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
51890799 |
cgtgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac |
51890881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 8965096 - 8965172
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
8965096 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
8965172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 29771368 - 29771285
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||||||||||||| |||| ||||| ||| ||| |||||| ||||| |
|
|
| T |
29771368 |
tcgtgagcttagctcaattggtagggatattgcatattatatgcaggggccggggttcgaaccccgggcactccacttctccac |
29771285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 361 - 451
Target Start/End: Complemental strand, 38848186 - 38848095
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcat-aatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| |||||||||| || |||| ||||| |||||||||||||| ||||| || ||||||| |
|
|
| T |
38848186 |
gagcttagctcaattggcagggatattgcataaatttatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaatgtg |
38848095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3036123 - 3036041
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
3036123 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacaccccacttctccac |
3036041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 21935483 - 21935561
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
21935483 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
21935561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 28520828 - 28520707
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
28520828 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
28520730 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
28520729 |
ctagccactaggctacctgacca |
28520707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 360 - 477
Target Start/End: Original strand, 29584648 - 29584765
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttct |
458 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||| ||||||| | |||| |||| | |||||| | |
|
|
| T |
29584648 |
tgagcttagctcaattggcag-gacattgcataatttatgcaggggccgaggttcgaaccccggacacctcacttattctccttgaaaaggagaattttt |
29584746 |
T |
 |
| Q |
459 |
atccactatactacttgac |
477 |
Q |
| |
|
| |||||| ||||||||| |
|
|
| T |
29584747 |
agccactaggctacttgac |
29584765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42002308 - 42002390
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || || |||||||||| |||| ||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
42002308 |
cgtgagcttagcttagttggtagggacattgcataatttatgtaggggccgtggtttgaacctcagacaccccacttctccac |
42002390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 49901484 - 49901566
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||| ||| ||||| |
|
|
| T |
49901484 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccgcttctccac |
49901566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 368 - 451
Target Start/End: Original strand, 40486453 - 40486536
Alignment:
| Q |
368 |
gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| ||||||| |||||| | ||| || ||||||| |
|
|
| T |
40486453 |
gctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtg |
40486536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 2629585 - 2629663
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||||||| || |||| ||||| || ||||||||||| ||||| |
|
|
| T |
2629585 |
agcttagctcaattggcagggacattgcataatttatgcaggggtcggggttcgaaccccgaacaccccacttctccac |
2629663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4234353 - 4234271
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| |||||||||| |||| |||| ||||||||||||| |||||| ||||| |
|
|
| T |
4234353 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttttccac |
4234271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 11375957 - 11375875
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
11375957 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccac |
11375875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 13578533 - 13578451
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
13578533 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac |
13578451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33933807 - 33933725
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||||||||||||||||||||||| |||| || || ||||||||||||| ||||| |
|
|
| T |
33933807 |
cgtgagcttagctcagttggtagggacattgcataatatatgcaggggccggggttcgacccctggacaccccacttctccac |
33933725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43147452 - 43147370
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
43147452 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
43147370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43596897 - 43596979
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
43596897 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
43596979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 46105537 - 46105619
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
46105537 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
46105619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 46775098 - 46775016
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
46775098 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
46775016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 47934140 - 47934058
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| ||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
47934140 |
cgtgagcttagctcagttggtagggatatggcatattatatgcaggggccggggttcgaaccccggacactccacttctccac |
47934058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 55251419 - 55251337
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
55251419 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
55251337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 366 - 466
Target Start/End: Original strand, 14149799 - 14149899
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac |
464 |
Q |
| |
|
||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||||| |||| |
|
|
| T |
14149799 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttctagccac |
14149897 |
T |
 |
| Q |
465 |
ta |
466 |
Q |
| |
|
|| |
|
|
| T |
14149898 |
ta |
14149899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 31852351 - 31852432
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| ||||||| || |||| ||||| |||||| |||||| |||| ||||| |||||||||||||| |||| |
|
|
| T |
31852351 |
cgtgagcttagctcagttggcagggacattgtataatttatgcaagggccgaggttcgaaccccggacaccccacttctcca |
31852432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 466
Target Start/End: Complemental strand, 48968307 - 48968199
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||| ||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
48968307 |
cgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
48968209 |
T |
 |
| Q |
457 |
ctatccacta |
466 |
Q |
| |
|
||| |||||| |
|
|
| T |
48968208 |
ctagccacta |
48968199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 6371116 - 6371192
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |
|
|
| T |
6371116 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
6371192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 356 - 479
Target Start/End: Original strand, 8690210 - 8690333
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaat |
454 |
Q |
| |
|
||||||||| ||||||| |||||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| |||||| |
|
|
| T |
8690210 |
ctcgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaat |
8690308 |
T |
 |
| Q |
455 |
ttctatccactatactacttgacca |
479 |
Q |
| |
|
||||| |||||| |||| |||||| |
|
|
| T |
8690309 |
ttctagccactaggctacctgacca |
8690333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 22230502 - 22230426
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |
|
|
| T |
22230502 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
22230426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 359 - 476
Target Start/End: Original strand, 46206580 - 46206705
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc--------tcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
|||||||||||||| |||| || || ||||||| ||||||||||||| || | || ||||| ||||||||||||||||| |||||||| | || |
|
|
| T |
46206580 |
gtgagcttagctcagttggtagggacattgcattatatatgcaggggtcgggattcgaaccccggacagtcggacaccccacttattcaccttaagaggt |
46206679 |
T |
 |
| Q |
451 |
gaatttctatccactatactacttga |
476 |
Q |
| |
|
||||||||| ||||||| |||||||| |
|
|
| T |
46206680 |
gaatttctagccactatgctacttga |
46206705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 52031205 - 52031324
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataa-tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| ||||||| | | ||||| | |||||||||||| || |||| ||||| | |||||||||||||| ||| |||||| |||||||| |
|
|
| T |
52031205 |
cgtgagcttagctcagttggcaggaacaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaa-gtgaattt |
52031303 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| ||||||| |||| |||| |
|
|
| T |
52031304 |
ctagccactatgctacctgac |
52031324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 55238567 - 55238491
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| ||||||||||||||| |||||||| |||| |||| |||||| |
|
|
| T |
55238567 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggggccggggtttgaatctcgaacactccactt |
55238491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 53376744 - 53376665
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||| |||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
53376744 |
gagcttagctcaattggtagggatattgcatgttatatgcaagggccggggttcgaaccccggacactccacttctccac |
53376665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3847683 - 3847765
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| || || ||||||| |||||| ||||| |
|
|
| T |
3847683 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgatccccggacactccacttctccac |
3847765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7686330 - 7686248
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
7686330 |
cgtgagcttagctcagttggtagagatattgcattttatatgcaggggccggggttcgaaccctggacactccacttctccac |
7686248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 26868351 - 26868432
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
26868351 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctccac |
26868432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34353781 - 34353863
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||| || | |||| ||||| |||||||||||||| ||||| |
|
|
| T |
34353781 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcagggttcgaaccccggacaccccacttctccac |
34353863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 39023177 - 39023259
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||| |||||| ||||| |
|
|
| T |
39023177 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac |
39023259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45139949 - 45139867
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||| ||||| ||||||||||||| |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
45139949 |
cgtgagcttagctcagttggtagggacattgtataatttatgcaggggccggggttcgaaccccggacacctcacttctccac |
45139867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 48569244 - 48569162
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
48569244 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac |
48569162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 50457782 - 50457700
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| |||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
50457782 |
cgtgagcttagctcagttggtaaggatattgcatattatatgcaggggccagggttcgaaccccggacactccacttctccac |
50457700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 393 - 479
Target Start/End: Complemental strand, 52330970 - 52330885
Alignment:
| Q |
393 |
atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||||||| ||| |||||| ||||||||| | |||||| ||||||||||| |
|
|
| T |
52330970 |
atatatgcaggggccggggttcgaactccggacaccccacttattcactttaaaa-gtgaatttccaaccactaagctacttgacca |
52330885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 53815694 - 53815815
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||| | |||| ||||| |||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
53815694 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcactataaaa-gtgaattt |
53815792 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
53815793 |
ctagccactaggctacctgacca |
53815815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 56088018 - 56087940
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||| | |||||||||||||| ||||| |
|
|
| T |
56088018 |
agcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaatcccggacaccccacttctccac |
56087940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 3784914 - 3785006
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| ||||||||| | | |||| ||||| || ||||| ||||| ||||| || ||||||| |
|
|
| T |
3784914 |
cgtgagcttagctcaattggtagggatattgcataatttatgcagggtcag-ggttcgaaccccgaacaccacacttctccacatttaaatgtg |
3785006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 451
Target Start/End: Complemental strand, 8848279 - 8848186
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca-cttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||| ||| |||| || ||||||||||| ||||| ||||||||| |||| ||||| ||||||||||| || ||||| |||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatatacaggggccggggttcgaaccccggacaccccatattctccacattaaaatgtg |
8848186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 24234134 - 24234073
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||| || |||| || ||||||| |
|
|
| T |
24234134 |
tatatgcaggggccggggtttgaaccccggacaccccacttattcatcttataaggtgaatt |
24234073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 29406360 - 29406441
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| || || |||||||||| |||||||||| || |||| |||| |||||| ||||||| ||||| |
|
|
| T |
29406360 |
gtgagcttagctcaattggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaacccacttctccac |
29406441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 42395230 - 42395311
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| | |||| || ||||||||||| |||||| |||||||| |||| |||| |||||||||||||| ||||| |
|
|
| T |
42395230 |
gtgagcttagcttagttggtagggatattgcatattatatgtaggggccggggttcgaactccggacaccccacttctccac |
42395311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 45112179 - 45112098
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
45112179 |
cgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcca |
45112098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 47018006 - 47017945
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
47018006 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
47017945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 32885723 - 32885794
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||||||||||| ||||||| || ||||| |||||||||||| |
|
|
| T |
32885723 |
tatatgcaggggtcggagttcgaacctcggacaccccacttattcaccttataaggtgaa-ttctatccacta |
32885794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 55853176 - 55853100
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| ||| ||||| || ||| ||||||| |
|
|
| T |
55853176 |
cgtgagcttagctcagttggtagagatattgcatattatatgcaggggccggtgttcgaaccccgaacatcccactt |
55853100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 477
Target Start/End: Original strand, 25780513 - 25780632
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggaca-ccccacttatccacctt-aaaatgtgaatttc |
457 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||||||||||| ||||||| |||| |||||| || ||||||| | |||| |||| | |||||| |
|
|
| T |
25780513 |
tgagcttaactcaattggcaaggacattgcataatatatgcaggggtcgtggttcgaacgccggacatcctcacttattcgccttgaaaaggaaaatttc |
25780612 |
T |
 |
| Q |
458 |
tatccactatactacttgac |
477 |
Q |
| |
|
|| |||||| ||||||||| |
|
|
| T |
25780613 |
tagtcactatgctacttgac |
25780632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 396 - 455
Target Start/End: Original strand, 36257731 - 36257790
Alignment:
| Q |
396 |
tatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
36257731 |
tatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaaagtgaatt |
36257790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 355 - 434
Target Start/End: Complemental strand, 56479297 - 56479219
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||| |||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| |
|
|
| T |
56479297 |
tctcgtgaacttaactcagttggtagggatattgcatattatatgcaggggtcg-ggttcgaaccccggacaccccactt |
56479219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 353 - 455
Target Start/End: Complemental strand, 56546550 - 56546448
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||| ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| ||| |||||| ||| |
|
|
| T |
56546550 |
agtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccggggttcgaaccacagacaccccacttattcactttaaaaagtg |
56546452 |
T |
 |
| Q |
452 |
aatt |
455 |
Q |
| |
|
|||| |
|
|
| T |
56546451 |
aatt |
56546448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 542882 - 542800
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| | ||||||||||| | |||| |||| |||||||| |||||| ||||| |
|
|
| T |
542882 |
cgtgagcttagctcagttgatagggatattgcatattgtatgcaggggctggggttcgaacttcggacactccacttctccac |
542800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 548947 - 548885
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||||||||||| ||||||| || |||||||| |
|
|
| T |
548947 |
tatatgcaggggccggggttcgaaactcagacaccccacttattcaccttataaggtgaattt |
548885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 637101 - 637183
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || |||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
637101 |
cgtgagcttagctcagctggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
637183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 1458082 - 1458004
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
1458082 |
agcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
1458004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 2222565 - 2222623
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
2222565 |
gatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac |
2222623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 472
Target Start/End: Original strand, 3465618 - 3465695
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac |
472 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||| ||||||| || ||||| ||||| |||||| ||||| |
|
|
| T |
3465618 |
tatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaa-ttctagccactagactac |
3465695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4958624 - 4958542
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
4958624 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
4958542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10402443 - 10402525
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||||| || ||| ||||| |||||||| ||||| ||||| |
|
|
| T |
10402443 |
cgtgagcttaactcagttggtagagatattgcatattatatgcaggggtcggagttcgaaccccggacacctcacttctccac |
10402525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 385 - 451
Target Start/End: Original strand, 13088938 - 13089004
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||| |||||||||| || |||| ||| |||||||||||||||| ||||| ||||| |||| |
|
|
| T |
13088938 |
attgcataatttatgcaggggtcggggttcgaatctcggacaccccacttttccacattaaattgtg |
13089004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 434
Target Start/End: Complemental strand, 13264340 - 13264266
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||| ||||| |||| || ||||||||||| |||||||| || ||| |||| ||||| |||||||||||||| |
|
|
| T |
13264340 |
tgagcttcgctcagttggtagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccactt |
13264266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 18360495 - 18360577
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| ||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
18360495 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
18360577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 393 - 443
Target Start/End: Complemental strand, 21765470 - 21765420
Alignment:
| Q |
393 |
atatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| |||||| |
|
|
| T |
21765470 |
atatatgcaggggccaaggttcgaacctcggacaccccacttattcacctt |
21765420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23924940 - 23924858
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| |||| ||||||||| || || |||||||||| ||||||||||||| |||| ||||| ||||||| ||||| ||||| |
|
|
| T |
23924940 |
cgtgaacttaactcaattggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacttcacttctccac |
23924858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25235865 - 25235783
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
25235865 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac |
25235783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 27362897 - 27362815
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| ||||||||| |||| ||||||||||||||| ||| ||||| || || |||||||| ||||| |
|
|
| T |
27362897 |
cgtgagcttaactcagttggtagcgatattacatattatatgcaggggccgacgttcgaaccccgaactccccacttctccac |
27362815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 366 - 440
Target Start/End: Original strand, 30057232 - 30057306
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||| || ||||||||||| |||||||||||| || |||| |||| |||||||||||||| ||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatgcaggggtcggggttcaaaccccggacaccccacttctccac |
30057306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 36008273 - 36008371
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| | |||||||||||||| |||| ||||| || ||||||||||||| ||||||| || ||||||| |
|
|
| T |
36008273 |
cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt |
36008371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36132231 - 36132313
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||||||||||||| || |||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
36132231 |
cgtgagtttagctcaattggtaggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
36132313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36602434 - 36602352
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| ||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
36602434 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
36602352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 37251115 - 37251197
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| | |||||||| |||| |||| |||| |||||||| |||||| ||||| |
|
|
| T |
37251115 |
cgtgagcttaactcagttggtagggatattgcatattttatgcaggagccggggttcgaacatcggacactccacttctccac |
37251197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40051624 - 40051706
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
40051624 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggtaggggttcgaaccccagacaccccacttctccac |
40051706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42381181 - 42381099
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || |||||||||| |||||| ||||| || |||| ||||||| |||||||||||| ||||| |
|
|
| T |
42381181 |
cgtgaacttagctcagttggtagggatattgcatgttatatgtaggggtcggggttcgaacctcagacaccccacttctccac |
42381099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43978010 - 43978091
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
43978010 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacc-cgtacactccacttctccac |
43978091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 49264528 - 49264610
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||| |||| || |||| || ||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
49264528 |
cgtgagtttaactcagttagcagagacattgcataacttatgcaggggccgaggttcgaaccccggacaccccacttctccac |
49264610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52757346 - 52757264
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||||| | |||| |||| || ||||||||| || ||||| |
|
|
| T |
52757346 |
cgtgagcttagctcagttggcaggaatattgcatattatatgcaggggttggggttcgaacttcagacaccccatttctccac |
52757264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 55055918 - 55056000
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || | |||||| | ||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
55055918 |
cgtgagcttagctcagttggtagggacaatgcatattttatgcaggggccgaggttcgaaccccggacacgccacttctccac |
55056000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 55536382 - 55536463
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| |||||||||| | || ||||||||||| |||||| |||||| ||||| |
|
|
| T |
55536382 |
cgtgagcttagctcagttggtaaggatattgcatattatatgcaggag-cggggtttgaaccttggacactccacttctccac |
55536463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 382 - 443
Target Start/End: Original strand, 6930577 - 6930638
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||||||||||||||| | || ||| |||||||||||||||| |||||| |
|
|
| T |
6930577 |
gatattgcataatatatgcaggggccgggattcaaactccggacaccccacttattcacctt |
6930638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 478
Target Start/End: Complemental strand, 15640540 - 15640420
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| || |||| ||||||| || | ||||| || |||||||| | || |||| ||||||| |||||||||||||| ||| |||||| |||||||| |
|
|
| T |
15640540 |
cgtgagcatatctcagttggcagagacaatgcattattatatgcagtgttcggggttcgaacctcagacaccccacttattcactttaaaa-gtgaattt |
15640442 |
T |
 |
| Q |
457 |
ctatccactatactacttgacc |
478 |
Q |
| |
|
||| |||||| ||||| ||||| |
|
|
| T |
15640441 |
ctagccactagactacctgacc |
15640420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 17872089 - 17872170
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||| |||||| || ||||||||||| ||||| ||||||||| |||| || | |||| ||||||||| |||| |
|
|
| T |
17872089 |
cgtgagcttagcttaattggtagggatattgcatagtatatacaggggccggggttcgagtcccggagaccccacttctcca |
17872170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 357 - 434
Target Start/End: Original strand, 20203427 - 20203504
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||| |||||||||| ||| |||| ||| |||||||| |||||| |
|
|
| T |
20203427 |
tcgtgagcttagctcatttggtagagatattgcatattatatgcaggagccaaggttcaaacttcggacactccactt |
20203504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 361 - 434
Target Start/End: Original strand, 25224477 - 25224550
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||| ||||| ||| || || |||||||||| |||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
25224477 |
gagcttaactcaactggtagggacattgcataatttatgcaggggtcggagttcgaacctcggacaccccactt |
25224550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 27308773 - 27308692
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||| |||||| || || | |||||||||||||||||| || |||| |||| ||||||||| | |||||||| |
|
|
| T |
27308773 |
cgtgagcttagcttaattggtagggacaacgcataatatatgcaggggtcggggttcgaacttcggacacctcccttatcca |
27308692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 38690666 - 38690743
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| |
|
|
| T |
38690666 |
tgagcttagctcacttggtaagggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttat |
38690743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 40150508 - 40150592
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||| |||||| || |||| ||||| |||||||| ||||||| ||| |||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
40150508 |
tatatacaggggtcggggttcgaaccccggacacctcacttattcactttaaaa-gtgaatttctatccattagactacctgacca |
40150592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 42081738 - 42081819
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||| ||||||| ||||||||||||| |||| |||||| | |||| ||| || |||||| |||||| ||||| |
|
|
| T |
42081738 |
gtgagcttagttcagttggcagagatattgcataatttatgtaggggctggggttcgaatcttggacactccacttctccac |
42081819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 44602487 - 44602548
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
44602487 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacc |
44602548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 46582637 - 46582718
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
46582637 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccagacactccacttctccac |
46582718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 47929272 - 47929329
Alignment:
| Q |
383 |
atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||||||||||| || |||| |||||||||| ||||||||| ||||| |
|
|
| T |
47929272 |
atattgcatattatatgcaggggtcgaggttcgaacctcggaaaccccacttctccac |
47929329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 53698040 - 53697979
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |||||| || ||||||| |
|
|
| T |
53698040 |
tatatgcaggggccggggttcgaaccccggacaccccacttatttaccttataaggtgaatt |
53697979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 12504713 - 12504629
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| |||| || |||||| ||||| |
|
|
| T |
12504713 |
ctcgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccac |
12504629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 387 - 431
Target Start/End: Complemental strand, 15334861 - 15334817
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacacccca |
431 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
15334861 |
tgcataatatatgcaggggccagggtttgaaccccggacacccca |
15334817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 21863951 - 21863871
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| | |||| || |||||||||||| |||||| ||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
21863951 |
tgagcttagcttagttggtaggaatattgcataatttatgcaaaagccgtggttcgaacatcggacaccccacttctccac |
21863871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 21919812 - 21919732
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| | |||| || |||||||||||| |||||| ||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
21919812 |
tgagcttagcttagttggtaggaatattgcataatttatgcaaaagccgtggttcgaacatcggacaccccacttctccac |
21919732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 406
Target Start/End: Complemental strand, 24680154 - 24680106
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggc |
406 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| |
|
|
| T |
24680154 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggc |
24680106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 26919536 - 26919460
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||| ||||||| |||||| |
|
|
| T |
26919536 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccactt |
26919460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 406
Target Start/End: Original strand, 30217601 - 30217649
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggc |
406 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| |
|
|
| T |
30217601 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggc |
30217649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 406
Target Start/End: Original strand, 37935863 - 37935911
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggc |
406 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| |
|
|
| T |
37935863 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggc |
37935911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 356 - 439
Target Start/End: Original strand, 33530793 - 33530876
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||| |||||| |||| || |||| ||||| |||| || |||||| |||| |
|
|
| T |
33530793 |
ctcgtgagcttagcttaattggtagggatattgcatattatatgtagggatcggggttcgaaccccggatactccacttctcca |
33530876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36099252 - 36099169
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| |||||||||| || || | ||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
36099252 |
cgtgagctttgctcaattggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccac |
36099169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 459
Target Start/End: Original strand, 36954134 - 36954236
Alignment:
| Q |
358 |
cgtgagcttagctcaa-ttggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| |||||||| ||||||| || | ||||| || ||||||||||| || |||| ||||| ||||||||||| |||| ||| |||||| ||||||| |
|
|
| T |
36954134 |
cgtgagcatagctcaagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattcactttaaaa-gtgaatt |
36954232 |
T |
 |
| Q |
456 |
tcta |
459 |
Q |
| |
|
|||| |
|
|
| T |
36954233 |
tcta |
36954236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Complemental strand, 41621335 - 41621288
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg |
405 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||||| |||||||||| |
|
|
| T |
41621335 |
cgtgagcttagctcaattgacagagatattgtataatttatgcagggg |
41621288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 49056776 - 49056859
Alignment:
| Q |
358 |
cgtgagctta-gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||| |||| || || |||||||| |||||||||| |||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
49056776 |
cgtgagcttaagctcagttggtagggacattgcatattatatgcaggagccggagttcgaaccccggacaccccacttctccac |
49056859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 451
Target Start/End: Original strand, 50512364 - 50512455
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||| |||| || |||||||||| |||||||||||| | |||| ||||||| |||||| |||| ||||| || ||||||| |
|
|
| T |
50512364 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggggttgaggttcgaacctctgacaccttacttctccacatttaaatgtg |
50512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 477
Target Start/End: Complemental strand, 54854275 - 54854155
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaat |
454 |
Q |
| |
|
||||||| ||||||| ||||||| || || ||||||| |||||||||||| | |||| ||||| |||||| | ||||||| |||||| |||| ||||| |
|
|
| T |
54854275 |
cgtgagcatagctcagttggcagggacat-gcataattatatgcaggggctggggttcgaaccccggacatcacacttattcaccttgaaaaaagtgaa- |
54854178 |
T |
 |
| Q |
455 |
ttctatccactatactacttgac |
477 |
Q |
| |
|
||||| |||||| |||||||||| |
|
|
| T |
54854177 |
ttctagccactagactacttgac |
54854155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 624482 - 624564
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| | || |||||||||| ||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
624482 |
cgtgagcttaactcagttggtaaggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccac |
624564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 2275072 - 2275130
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||| |||||||||||||| ||||| |
|
|
| T |
2275072 |
gatattgcatattatatgcagggatcgatgtttgaaccccggacaccccacttctccac |
2275130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3764076 - 3763994
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||| ||||||||||||| | |||| ||||| | || || |||||| ||||| |
|
|
| T |
3764076 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaaccccagatactccacttctccac |
3763994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3815062 - 3815144
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| |||||||||| || | |||| ||||| |||| || |||||| ||||| |
|
|
| T |
3815062 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccac |
3815144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4590248 - 4590330
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| ||||| ||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
4590248 |
cgtgagtttagctcagttggtagggatattgcatattatatacaggggctgaggttcgaaccccagacactccacttctccac |
4590330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 5165859 - 5165940
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||| ||||| ||||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
5165859 |
cgtgagcttaactcagttggtagggatatcgcatattatatgcaggggccggggttcgaacc-ccgacactccacttctccac |
5165940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 5179926 - 5179868
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
5179926 |
gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
5179868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 5305078 - 5304996
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || |||| |||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
5305078 |
cgtgagcttatctcagttggtaggaatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccac |
5304996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 352 - 477
Target Start/End: Complemental strand, 9285761 - 9285637
Alignment:
| Q |
352 |
cagtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
||||| ||||||| |||||||||||| || || | ||||| || |||||||||| | | |||| ||||| | |||||||||||||| |||||| || || |
|
|
| T |
9285761 |
cagtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcagggtctggggttcgaaccccagacaccccacttattaaccttataaggt |
9285663 |
T |
 |
| Q |
451 |
gaatttctatccactatactacttgac |
477 |
Q |
| |
|
||| ||||| |||||| |||||||||| |
|
|
| T |
9285662 |
gaa-ttctagccactagactacttgac |
9285637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9761117 - 9761199
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| ||||| ||||| |
|
|
| T |
9761117 |
cgtgagcttacctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccac |
9761199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 12582072 - 12582014
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
12582072 |
gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
12582014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 12820502 - 12820404
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| | ||||||||||| || |||| ||||| ||||||||||||||| ||||||| || ||||||| |
|
|
| T |
12820502 |
cgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcaccttataaggtgaatt |
12820404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 15604108 - 15604026
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||| |||||| |||||||||||| || | || ||||| ||||||| |||||| ||||| |
|
|
| T |
15604108 |
cgtgagcttagctcagttggtagggatgttgcattttatatgcaggggtcgggattcgaaccccggacactccacttctccac |
15604026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 17617024 - 17616966
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
17617024 |
gatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
17616966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23705221 - 23705139
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| || ||||||| || | |||| ||||| ||||||| ||||| ||||| |
|
|
| T |
23705221 |
cgtgagcttagctcagttggtagggatattgcatattacatgcaggagctggggttcgaaccccggacacttcacttctccac |
23705139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 31601841 - 31601891
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||||| | || ||||| |||||||||||||||| ||||||| |
|
|
| T |
31601841 |
tatatgcaggggccgagattcgaaccccggacaccccacttattcacctta |
31601891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 35219568 - 35219487
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| || ||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
35219568 |
cgtgagcttagctcagttggtagggatattgcatatta-atgcaggagtcggggttcgaaccccggacactccacttctccac |
35219487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 35230355 - 35230271
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaat--gtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
|||||||| ||| || |||| |||||||||||||||||||||| ||||| |||| |||||||| || |||||| |||||||||| |
|
|
| T |
35230355 |
tatatgcatgggtcggggttcgaacctcggacaccccacttatttaccttgaaataggtgaattt-tagccactagactacttgac |
35230271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 37868611 - 37868553
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||||||| | ||| |||||||||||||| ||||| ||||| |
|
|
| T |
37868611 |
gatattgcatattatatgcaggggctggagttcgaacctcggacacctcacttctccac |
37868553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 41897591 - 41897533
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| ||||| | ||||||||||| ||||| |
|
|
| T |
41897591 |
gatattgcataatatatgcacgggccgaggttcgaaccctgtacaccccacttctccac |
41897533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 401
Target Start/End: Original strand, 43027292 - 43027334
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgca |
401 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
43027292 |
gtgagcttagctcaattggtagtgataatgcataatatatgca |
43027334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43271785 - 43271703
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| ||| || ||||||||||| ||||||||||| || |||| ||||| | |||||||||||| ||||| |
|
|
| T |
43271785 |
cgtgagcttagttcagttgatagggatattgcatattatatgcagggaccagggttcgaaccccagacaccccacttctccac |
43271703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43481107 - 43481026
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
43481107 |
cgtgagcttaactcagttggtagggatattgcactttatatgcaggggccggggttcgaacc-cggacactccacttctccac |
43481026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 45126134 - 45126216
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||||||| || | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
45126134 |
cgtgagcttagctcagttggtagggatattgtatattatatgcaggagctgaggttcgaaccccagacactccacttctccac |
45126216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 45849049 - 45849131
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| | ||||||||||| | ||| ||||| |||||| |||||| ||||| |
|
|
| T |
45849049 |
cgtgagcttagctcagttggtagggatattgcatattttatgcaggggctggagttcgaaccctggacactccacttctccac |
45849131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 51512077 - 51511995
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||||| |||| || ||||||||||| ||||||| | |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
51512077 |
cgtgagctgagctcagttggtagggatattgcatattatatgctgtagccggggttcgaaccccggacactccacttctccac |
51511995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 627049 - 626968
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| |||||||| |||| || ||||||||||| |||||||| | || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatgcaagagctggggttcgaaccccggacactccacttctccac |
626968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 451
Target Start/End: Original strand, 2688122 - 2688191
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||| |||||||||| || |||||| ||| | ||||||||||| || ||||| || ||||||| |
|
|
| T |
2688122 |
gatattgcatattatatgcaggagctgtggttcgaatcccggacaccccatttctccacatttaaatgtg |
2688191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 7768848 - 7768795
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||| ||||| |||| ||||| |||||||||||||||| ||| |||||| |
|
|
| T |
7768848 |
tatatgcagaggccggggttcgaaccccggacaccccacttattcactttaaaa |
7768795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 451
Target Start/End: Complemental strand, 9477480 - 9477411
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||| | |||||||||||||| ||| |||||||||| |
|
|
| T |
9477480 |
gatattgcatattatatgcagggatcgtggttcaaactccagacaccccacttattcacattaaaatgtg |
9477411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 9924891 - 9924975
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
|||||||||||| || |||| ||||| ||||||| |||||||| |||||| | |||||||| ||||||||| ||||| |||||| |
|
|
| T |
9924891 |
tatatgcaggggtcggggttcgaaccccggacactccacttattcaccttgtatggtgaattt-tatccactagactacctgacca |
9924975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 10098160 - 10098244
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| | || ||||| |||||||||||||||| || |||| || |||| ||||| |||||| ||||| |||||| |
|
|
| T |
10098160 |
tatatgcaggggccgggattcgaaccccggacaccccacttattcatcttataagatgaa-ttctagccactagactacctgacca |
10098244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 427
Target Start/End: Original strand, 19963808 - 19963853
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
||||||||||| |||||||||||| || |||| ||||||||||||| |
|
|
| T |
19963808 |
gatattgcatattatatgcaggggtcggggttcgaacctcggacac |
19963853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Original strand, 20610774 - 20610827
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||||||| |||| |||| |||||| ||||||||| |||||||||| |
|
|
| T |
20610774 |
tatatgcaggggccggggttcgaactccggacatcccacttattcaccttaaaa |
20610827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 26885495 - 26885418
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||||| | |||| |||| | ||||||| ||||||| |||| ||||| ||||||| |||||||| |
|
|
| T |
26885495 |
tgagcttagctcatttggcaggggataatgcacattatatgctggggccggggttcgaaccccggacactccacttat |
26885418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 29257055 - 29256974
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| |||||||| ||||||| ||||||||||||| ||||||| |||| ||| ||||| | |||||||| ||| ||||| |
|
|
| T |
29257055 |
gtgaggttagctcagttggcagagatattgcataatttatgcagcggccagagttcgaaccccagacaccccgcttctccac |
29256974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Original strand, 33076565 - 33076618
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
|||||||||||| || |||| ||||| ||||||||| |||||| |||||||||| |
|
|
| T |
33076565 |
tatatgcaggggtcggggttcgaaccccggacaccctacttattcaccttaaaa |
33076618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 34773743 - 34773682
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||| | |||| ||||| |||||||||||||||| ||| ||| || ||||||| |
|
|
| T |
34773743 |
tatatgcaggggctgaggttcgaaccccggacaccccacttattcactttataaggtgaatt |
34773682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 37032239 - 37032178
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || | || ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
37032239 |
tatatgcaggggtcgggattcgaaccccggacaccccacttattcaccttataaggtgaatt |
37032178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 43207671 - 43207716
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |
|
|
| T |
43207671 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43207716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 46998435 - 46998354
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| | |||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
46998435 |
gtgagcttagctcagttggtatgaatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
46998354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 478
Target Start/End: Original strand, 48512197 - 48512317
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| | |||||||||||| |||| | ||| |||||||||||||||| ||||||| || |||||||| |
|
|
| T |
48512197 |
cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttcgtaccccggacaccccacttattcaccttataaggtgaattt |
48512296 |
T |
 |
| Q |
457 |
ctatccactatactacttgacc |
478 |
Q |
| |
|
|| |||||| |||| |||||| |
|
|
| T |
48512297 |
-tagccactagactatttgacc |
48512317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 51777846 - 51777939
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||| |||||||| || | ||| |||||||||| ||||||||||| || |||| |||| |||||| ||||||| ||||| || ||||||| |
|
|
| T |
51777846 |
cgtgagtttagctcagttagtagctatattgcatattatatgcagggatcggggttcgaactccggacatcccacttctccacatttaaatgtg |
51777939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 397 - 466
Target Start/End: Complemental strand, 53355023 - 53354955
Alignment:
| Q |
397 |
atgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||| || |||||| |||||||||| |||||| |
|
|
| T |
53355023 |
atgcaggggccggggttcgaaccccggacaccccacttatttactttaaaa-atgaatttctaaccacta |
53354955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 55260380 - 55260299
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| | |||| || || |||||||||| |||| |||||| | |||| ||||||| ||||| |||||| ||||| |
|
|
| T |
55260380 |
gtgagcttagcttagttggtagggacattgcataatttatgtaggggcagaggttcgaacctctgacactccacttctccac |
55260299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 56555583 - 56555632
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||||||||||| || |||| |||||||| ||||||||||||| |||||| |
|
|
| T |
56555583 |
tatatgcaggggtcggggttcgaacctcgaacaccccacttattcacctt |
56555632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 5e-21; HSPs: 107)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 17064928 - 17064844
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||| ||||||||||||||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
17064928 |
ctcgtgagcttaactcaattggtagggatattgcatattatatgcaggggccgacgtttgaaccccggacaccccacttctccac |
17064844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 1269235 - 1269153
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
1269235 |
cgtgagcttagctcaattggtagagatattgcatattatatgcaggggccaaagttcgaacctcggacaccccacttctccac |
1269153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 6447577 - 6447456
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| || |||| ||||||| || | ||||| || |||||||||||||| |||| |||||||||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
6447577 |
cgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcactttaaaa-atgaattt |
6447479 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| ||||| |||||| |
|
|
| T |
6447478 |
ctaaccactacactacctgacca |
6447456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 12891559 - 12891641
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
12891559 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccacttctccac |
12891641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 13622014 - 13621932
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| ||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
13622014 |
cgtgagcttagctcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
13621932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 17545240 - 17545159
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
17545240 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctcca |
17545159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 479
Target Start/End: Complemental strand, 4674914 - 4674791
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaat |
454 |
Q |
| |
|
||||||||| ||||||| ||| ||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| |||||| |
|
|
| T |
4674914 |
ctcgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaat |
4674816 |
T |
 |
| Q |
455 |
ttctatccactatactacttgacca |
479 |
Q |
| |
|
||||| |||||| ||||| |||||| |
|
|
| T |
4674815 |
ttctaaccactaaactacctgacca |
4674791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 359 - 464
Target Start/End: Original strand, 1463870 - 1463975
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc |
457 |
Q |
| |
|
|||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
1463870 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttc |
1463968 |
T |
 |
| Q |
458 |
tatccac |
464 |
Q |
| |
|
|| |||| |
|
|
| T |
1463969 |
tagccac |
1463975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4417753 - 4417671
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
4417753 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
4417671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 5966831 - 5966952
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac-cttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| ||||| |||| | || |
|
|
| T |
5966831 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg-agtt |
5966929 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||||||||||| |
|
|
| T |
5966930 |
ctagccactagactacttgacca |
5966952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6558803 - 6558885
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||||| || |||| |||| ||||||||| |||| ||||| |
|
|
| T |
6558803 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggtcggggttcgaactccggacaccctacttctccac |
6558885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8968751 - 8968833
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
8968751 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
8968833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9125665 - 9125746
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||||||| |||||| |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
9125665 |
cgtgagcttagctcagttggtagcgatattgcatattatatgca-gggccggggttcgaaccccggacacctcacttctccac |
9125746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9835035 - 9835117
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
9835035 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
9835117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 12463758 - 12463840
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
12463758 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
12463840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 14641177 - 14641095
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
14641177 |
cgtgagcttaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
14641095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 15241398 - 15241480
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || |||||||||| |||||||||||| || |||| |||||||||||||||||||| ||||| |
|
|
| T |
15241398 |
cgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccac |
15241480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24477827 - 24477909
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || ||||||||||||||||||| |||||| |||||||||||||||||||| ||||| |
|
|
| T |
24477827 |
cgtgagcttagctcagttggtagggacgttgcataatatatgcagggtatgtggttcgaacctcggacaccccacttctccac |
24477909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32505690 - 32505772
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
32505690 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
32505772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42916391 - 42916473
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| || ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
42916391 |
cgtgagcttagctcagttggtagggatattgtatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac |
42916473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 8241054 - 8241134
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||| ||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
8241054 |
tgagcttagctcagttggtagggatattgcatattatatgcaagggtcggggttcgaaccccggacaccccacttctccac |
8241134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 364 - 440
Target Start/End: Complemental strand, 20145626 - 20145550
Alignment:
| Q |
364 |
cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| | |||| || ||||||||||||| |||||| |||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
20145626 |
cttagcttagttggtagggatattgcataatttatgcaagggccggggttcgaacctcggacaccccacttctccac |
20145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 24033082 - 24033161
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
24033082 |
gagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacacgccacttctccac |
24033161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3198329 - 3198411
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || ||||||||||||||||||||| | |||| ||||| ||||||||| |||| ||||| |
|
|
| T |
3198329 |
cgtgagcttagctcagttggtagggacattgcataatatatgcaggggttgaggttcgaaccccggacaccctacttctccac |
3198411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4745944 - 4745862
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
4745944 |
cgtgagcttagctcagttggtagggatattgcatattatatgaaggagccggggttcgaaccccggacactccacttctccac |
4745862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6518844 - 6518762
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6518844 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac |
6518762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11897250 - 11897332
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
11897250 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
11897332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 23155895 - 23155977
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| ||||||| ||||| |||| |||| || |||||| |||| ||||| |
|
|
| T |
23155895 |
cgtgagcttagctcaattggcagggacattgcataatttatgcagaggccgaggttcgaactccgaacacccaacttctccac |
23155977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23292485 - 23292403
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||| | |||| |||||||||||||||||||| ||||| |
|
|
| T |
23292485 |
cgtgagcttagctcagttggtagggatattgcatgttatatgcagggtttggggttcgaacctcggacaccccacttctccac |
23292403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 32158510 - 32158413
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||||||||||| || || | ||||| || |||||||||||||| |||| ||||| || ||||||||||||| ||||||| || ||||||| |
|
|
| T |
32158510 |
cgtgagcttagctcaattggtag-gacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt |
32158413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 35515514 - 35515596
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||||| ||||| |
|
|
| T |
35515514 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacacttcacttctccac |
35515596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 41179871 - 41179789
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
41179871 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac |
41179789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42525402 - 42525484
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
42525402 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
42525484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 10943751 - 10943812
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
10943751 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaaagtgaatt |
10943812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 18928723 - 18928804
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||| |||||||||| || ||| ||||| |||||||| ||||| ||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcataatttatgcaggggtcggtgttcgaaccacggacacctcacttttccac |
18928804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 25400434 - 25400353
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
25400353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 32226288 - 32226231
Alignment:
| Q |
383 |
atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||||||||||| || |||| |||||||||||||||||||| ||||| |
|
|
| T |
32226288 |
atattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccac |
32226231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 546804 - 546880
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| |||||||| ||| ||||||| |
|
|
| T |
546804 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcgaacatcccactt |
546880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 1743129 - 1743204
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |
|
|
| T |
1743129 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccactt |
1743204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 17175117 - 17175037
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||| ||| |||| |||| || |||||||||| ||||||||||||||| |||| ||||||||||||| |||||| ||||| |
|
|
| T |
17175117 |
tgagtttaactcagttggtagggatattgcatgttatatgcaggggccggggttcgaacctcggacactccacttctccac |
17175037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 450
Target Start/End: Original strand, 26912835 - 26912927
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||| |||||| |||||||| |||| ||||| | |||||| |||| ||||| ||| ||||| |
|
|
| T |
26912835 |
cgtgagcttaactcaattggtagggatattgcatattatatgtaggggccggggttcgaaccccaaacaccctacttctccacattataatgt |
26912927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 18638603 - 18638682
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| || ||||| |||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
18638682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2328594 - 2328676
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
2328594 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccac |
2328676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4067984 - 4068066
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || | |||||| | |||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
4067984 |
cgtgagcttagctcagttggtagggacaatgcatattttatgcagggggcgaggttcgaaccccggacaccccacttctccac |
4068066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 5900294 - 5900375
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
5900294 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccg-ggttcgaaccccggacattccacttctccac |
5900375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 436
Target Start/End: Complemental strand, 6614098 - 6614056
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6614098 |
tatatgcaggggccggggttcgaacctcggacaccccacttat |
6614056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 397 - 455
Target Start/End: Original strand, 8015873 - 8015931
Alignment:
| Q |
397 |
atgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
8015873 |
atgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
8015931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 11774527 - 11774445
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| || | || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
11774527 |
cgtgaccttagctcagtttgtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
11774445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 366 - 479
Target Start/End: Complemental strand, 20735264 - 20735151
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac |
464 |
Q |
| |
|
||||||| ||||||| || | ||||| || ||||| |||||||| |||| ||| | |||||||||||||||| ||| |||||| ||||||||||| |||| |
|
|
| T |
20735264 |
tagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttattcactttaaaa-gtgaatttctagccac |
20735166 |
T |
 |
| Q |
465 |
tatactacttgacca |
479 |
Q |
| |
|
|| |||| |||||| |
|
|
| T |
20735165 |
taggctacctgacca |
20735151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 21918054 - 21918136
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| |||||| |||||| ||||| |
|
|
| T |
21918054 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctggacactccacttctccac |
21918136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 27765259 - 27765341
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
27765259 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccac |
27765341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36888463 - 36888381
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
36888463 |
cgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
36888381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 39919161 - 39919087
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||| |
|
|
| T |
39919161 |
cgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
39919087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43580880 - 43580962
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
43580880 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac |
43580962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 27241643 - 27241736
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||||| || | || ||||| |||| |||||||||||| || ||||| ||| |||| ||||||||| ||||| |||||||||| |
|
|
| T |
27241643 |
cgtgagcttagctcagtttgtaggaatattacatattatatgcaggggtcggggtttaaactccggataccccacttctccacattaaaatgtg |
27241736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 30403785 - 30403846
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||| ||||||||| ||||||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
30403785 |
tatatacaggggccggagtttgaaccccggacaccccacttattcaccttataaggtgaatt |
30403846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 30819226 - 30819275
Alignment:
| Q |
352 |
cagtctcgtgagcttagctcaattggcagcgatattgcataatatatgca |
401 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
30819226 |
cagtcccgtgagcttagctcaattggtagagatattgcattatatatgca |
30819275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 31250147 - 31250224
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
31250147 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
31250224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 33729813 - 33729874
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||||||||||| ||||||| || ||||||| |
|
|
| T |
33729813 |
tatatgcaggggccggggttcgaatctcagacaccccacttattcaccttataaggtgaatt |
33729874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 459
Target Start/End: Complemental strand, 36045194 - 36045130
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta |
459 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
36045194 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttcta |
36045130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 38503352 - 38503275
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
38503352 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
38503275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 38618741 - 38618680
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||| |||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
38618741 |
tatatgcaagggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
38618680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 43227866 - 43227943
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
43227866 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
43227943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 16386807 - 16386727
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| |||| || |||||| ||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccac |
16386727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 395 - 455
Target Start/End: Complemental strand, 19059063 - 19059003
Alignment:
| Q |
395 |
atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||||||||| ||||||| || ||||||| |
|
|
| T |
19059063 |
atatgcaggggccggggttcgaaccctggacaccccacttattcaccttataaggtgaatt |
19059003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 25346219 - 25346290
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
||||||||||||||| |||| ||| | |||||||||||| ||| ||| |||||| ||||||||||| |||||| |
|
|
| T |
25346219 |
tatatgcaggggccggggttcgaatcccggacaccccacgtattcactttaaaa-gtgaatttctagccacta |
25346290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 432
Target Start/End: Complemental strand, 36564492 - 36564416
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
|||||||||||| || |||||| || |||||| ||||||||||| ||||||| ||| ||||| |||||||||||| |
|
|
| T |
36564492 |
ctcgtgagcttaacttaattggtaggaatattgtataatatatgctggggccggagttcgaaccacggacaccccac |
36564416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 36716924 - 36716844
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| ||| || ||||||||||| ||||||||||| ||| |||||||||| ||||||| | |||| ||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagggaccggggtttgaaccccggacactcaacttctccac |
36716844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Complemental strand, 18049689 - 18049642
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg |
405 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| ||| |||||| |
|
|
| T |
18049689 |
cgtgagcttagctcaattggtagggatattgcataatttatacagggg |
18049642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 353 - 455
Target Start/End: Original strand, 18477997 - 18478099
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||| ||||||| |||| || || | ||||| || |||||| ||||||| |||| ||||| ||||||||||||||| ||||||| || ||| |
|
|
| T |
18477997 |
agtctcgtgagcatagctcagttggtag-gacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttattcaccttataaggtg |
18478095 |
T |
 |
| Q |
452 |
aatt |
455 |
Q |
| |
|
|||| |
|
|
| T |
18478096 |
aatt |
18478099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 429
Target Start/End: Original strand, 24456192 - 24456262
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc |
429 |
Q |
| |
|
||||||| ||||||||||||||| || |||||||||| |||||||||| || ||| ||||| ||||||||| |
|
|
| T |
24456192 |
cgtgagcatagctcaattggcag-gacattgcataatttatgcaggggtcggagttcgaaccccggacaccc |
24456262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 33018590 - 33018512
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||| ||| || ||||||||||||| |||||| ||| || |||| |||| ||||||||||||||| ||||| |
|
|
| T |
33018590 |
gagcttaactcaactggtagggatattgcataatttatgca-gggtcggggttcgaacttcggacaccccacttctccac |
33018512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 373 - 440
Target Start/End: Complemental strand, 37553978 - 37553911
Alignment:
| Q |
373 |
attggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| || |||||||||| ||||||| ||||| |||| |||| | |||||||||||||||||| |
|
|
| T |
37553978 |
attggcagggacattgcataatttatgcagaggccgaggttcgaactccagacaccccacttatccac |
37553911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 40276511 - 40276428
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||||||| |||| || |||||||||| ||||||||||||| | | || ||||| ||||| |||||||| ||||| |
|
|
| T |
40276511 |
tcgtgagtttagctcagttggtaggaatattgcatattatatgcaggggctgagattcgaaccccggacgccccacttctccac |
40276428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 385 - 447
Target Start/End: Complemental strand, 7064839 - 7064777
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
|||||||| |||||||||||| || | ||| ||| ||||||||||||||||| | |||||||| |
|
|
| T |
7064839 |
attgcatactatatgcaggggtcgggatttaaacatcggacaccccacttattctccttaaaa |
7064777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 7631117 - 7631055
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
|||||| ||||| || |||||||||||| ||||||||||||| ||| |||||| |||||||| |
|
|
| T |
7631117 |
tatatgtaggggtcgaggtttgaacctcaaacaccccacttattcacattaaaaagtgaattt |
7631055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 13876385 - 13876307
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| || ||||||| ||| ||||||||| ||||| |||| ||||| ||||||| ||| || ||||| |
|
|
| T |
13876385 |
agcttagctcaattgatagagatattgtatattatatgcagcggccggggttcgaaccccggacactccatttctccac |
13876307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 396 - 466
Target Start/End: Original strand, 16263775 - 16263845
Alignment:
| Q |
396 |
tatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
||||||||||||| |||| |||| |||| |||||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
16263775 |
tatgcaggggccggggttctaaccccggattccccacttattcaccttaaagggtgaatttctagccacta |
16263845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 17891891 - 17891845
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
17891891 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccac |
17891845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 18050197 - 18050263
Alignment:
| Q |
374 |
ttggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||| |||||||||||||| || ||||||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
18050197 |
ttggtagcgatattgcatattaaatgcaggggtcggggttcgaaccccggacactccacttctccac |
18050263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 404
Target Start/End: Original strand, 19985502 - 19985548
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggg |
404 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
19985502 |
cgtgaccttagctcagttggtagggatattgcataatatatgcaggg |
19985548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25729508 - 25729426
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| |||||||||||| || |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
25729508 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaaccccagacactccacttctccac |
25729426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32706324 - 32706406
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||| |||||| ||| |||| | || ||||| ||||||| |||||| ||||| |
|
|
| T |
32706324 |
cgtgagcttagctcagttggtagggatattacatattatatggaggagccgggattcgaaccccggacactccacttctccac |
32706406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 33800928 - 33800978
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||||| |||| ||||| | |||||||||||||| ||||||| |
|
|
| T |
33800928 |
tatatgcaggggccggggttcgaaccccagacaccccacttattcacctta |
33800978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 35241398 - 35241479
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| |||||||||||| || |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
35241398 |
cgtgagcttagttcagttggtagagatattgcatattatatgcaggggtcggggttcgaacc-ctgacactccacttctccac |
35241479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36124401 - 36124483
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || |||||||||| |||||||||||| || |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
36124401 |
cgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaatcccggacactccacttctccac |
36124483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39800098 - 39800016
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || | |||||||| ||||||||||| | || | ||||| | |||||||||||| ||||| |
|
|
| T |
39800098 |
cgtgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggctcgaacccctgacaccccacttctccac |
39800016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39886280 - 39886198
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||| ||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
39886280 |
cgtgagcatagctcagttggtagggatattgcatattatatgtaggagctggggttcgaaccccggacactccacttctccac |
39886198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40091479 - 40091561
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||| | |||| |||| |||| ||||||| |||||| ||||| |
|
|
| T |
40091479 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaagagccgaggttcgaactccggacactccacttctccac |
40091561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42320319 - 42320401
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || ||| ||||| || |||| |||||| ||||| |
|
|
| T |
42320319 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggagttcgaaccccgaacactccacttctccac |
42320401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 410 - 479
Target Start/End: Original strand, 42355724 - 42355794
Alignment:
| Q |
410 |
ggtttgaacctcggacaccccacttatccacc-ttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| |||| | ||||||||||| ||| || ||||||||||| |
|
|
| T |
42355724 |
ggtttgaaccccggacaccccacttattcacctttaagaggtgaatttctagccattaggctacttgacca |
42355794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 3535996 - 3535943
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||| |||| |||| |||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
3535996 |
tatatacaggagccggggttcgaaccccggacaccccacttattcaccttaaaa |
3535943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 355 - 404
Target Start/End: Original strand, 6414067 - 6414116
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggg |
404 |
Q |
| |
|
||||||||||||| |||| |||| || ||||||||||| ||||||||||| |
|
|
| T |
6414067 |
tctcgtgagcttaactcagttggtagggatattgcatattatatgcaggg |
6414116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 8478961 - 8478900
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
|||||| |||| ||| |||| || ||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
8478961 |
cgtgagtttagttcagttggtagggatattgcatattatatgcaggggctgtggttcgaacc |
8478900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 439
Target Start/End: Original strand, 13958408 - 13958465
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||| |||||||||||| || |||| ||||| ||||||| |||||| |||| |
|
|
| T |
13958408 |
gatattgcatattatatgcaggggacggggttcgaaccccggacactccacttctcca |
13958465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 18102009 - 18101956
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||||||| ||| ||||| | |||||||||||||| |||||||||| |
|
|
| T |
18102009 |
tatatgcaggggccggagttcgaaccccagacaccccacttattcaccttaaaa |
18101956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 20945951 - 20945890
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
20945951 |
tatatgcaggggccggggttcgaaatccggacaccccacttattcaccttataaggtgaatt |
20945890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 25648153 - 25648092
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| || ||||||| |||| |||| ||||| |
|
|
| T |
25648153 |
cgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaacc |
25648092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 29096368 - 29096307
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||| |||||| ||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
29096368 |
tatatgcaagggccggagttcgaaccccggacaccccacttattcaccttataaggtgaatt |
29096307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 29154846 - 29154926
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || |||| |||||| |||||| ||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgtaggagccg-ggttcgaaccccggacactccacttctccac |
29154926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 356 - 413
Target Start/End: Original strand, 34436848 - 34436905
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt |
413 |
Q |
| |
|
||||||||||||||||| |||| || || | ||||||||||||||| |||||| |||| |
|
|
| T |
34436848 |
ctcgtgagcttagctcagttggtagggacaatgcataatatatgcaagggccggggtt |
34436905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 443
Target Start/End: Original strand, 34729495 - 34729555
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
34729495 |
gataatgcatattatatgcaggggtcggggttcgaacc-cggacaccccacttattcacctt |
34729555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 433
Target Start/End: Original strand, 37034810 - 37034883
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact |
433 |
Q |
| |
|
|||||||||||||||||| || ||||| |||| |||||||||| |||| ||| ||||| ||||||| ||||| |
|
|
| T |
37034810 |
tgagcttagctcaattggtagggatatcgcattttatatgcaggagccggagttcgaaccccggacactccact |
37034883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 466
Target Start/End: Complemental strand, 37417226 - 37417119
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgca-taatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| ||||||| || | | || || |||||||||||||| |||| ||||| | ||||||||||||| ||| |||||| |||||||| |
|
|
| T |
37417226 |
cgtgagcttagctcagttggcagggacaatacattattatatgcaggggccagggttcgaacc-ctgacaccccacttactcactttaaaa-gtgaattt |
37417129 |
T |
 |
| Q |
457 |
ctatccacta |
466 |
Q |
| |
|
||| |||||| |
|
|
| T |
37417128 |
ctagccacta |
37417119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 355 - 408
Target Start/End: Complemental strand, 39028104 - 39028051
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg |
408 |
Q |
| |
|
||||||||| |||||||| |||| || ||||||||||| |||||||| |||||| |
|
|
| T |
39028104 |
tctcgtgagattagctcatttggtagggatattgcatattatatgcaagggccg |
39028051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 415
Target Start/End: Original strand, 41127021 - 41127078
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttg |
415 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||| ||||||||||| | |||||| |
|
|
| T |
41127021 |
cgtgagcttagctcagttggcaggaacattgcataatttatgcaggggctggggtttg |
41127078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 42455454 - 42455393
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||| |||||||| ||||||| || ||||||| |
|
|
| T |
42455454 |
tatatgcaggggccggagttcgaaccccggacactccacttattcaccttataaggtgaatt |
42455393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 52; Significance: 2e-20; HSPs: 97)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 358 - 477
Target Start/End: Complemental strand, 6658639 - 6658521
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc |
457 |
Q |
| |
|
||||||||||||| | || | || || |||||||||||||||||||||||| |||| ||||| |||||||||||||||| | |||||||| | ||||||| |
|
|
| T |
6658639 |
cgtgagcttagcttagttagtagggaaattgcataatatatgcaggggccggggttcgaaccccggacaccccacttattctccttaaaa-gagaatttc |
6658541 |
T |
 |
| Q |
458 |
tatccactatactacttgac |
477 |
Q |
| |
|
|| |||||| ||||||||| |
|
|
| T |
6658540 |
tagccactaggctacttgac |
6658521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2251840 - 2251922
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
2251840 |
cgtgagcttagctcagttggtagggatattgcatactatatgcaggggccggggttcgaaccccggacaccccacttctccac |
2251922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32166371 - 32166453
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||||| | |||||||| ||||||| |||||| ||||| |
|
|
| T |
32166371 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggccgggatttgaaccccggacactccacttctccac |
32166453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 3640514 - 3640598
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||| |||||| |||| ||||||||||||| |||||| ||||| |
|
|
| T |
3640514 |
ctcgtgagcttagctcagttggtagggatattgcatagtatatgcaagggccggggttcgaacctcggacactccacttctccac |
3640598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 492904 - 492986
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| ||||||||||||||| |||| ||||| ||||||||||||| ||||| |
|
|
| T |
492904 |
cgtgagcttagctcagttggcaaggatattgcatattatatgcaggggccggggttcgaaccctggacaccccacttctccac |
492986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7865423 - 7865341
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||||||||| |||||| |||||| ||||| |
|
|
| T |
7865423 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttgaaccctggacactccacttctccac |
7865341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8297629 - 8297711
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
8297629 |
cgtgagcttagctcaattggtagggatgttgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac |
8297711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 15091450 - 15091532
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||| | |||||||||||||| ||||| |
|
|
| T |
15091450 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccac |
15091532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 459
Target Start/End: Complemental strand, 20568353 - 20568251
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta-aaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| |||| | || ||||||||||||||||||||| || |||| ||||| || ||||||||||||| ||||||| ||| |||||||| |
|
|
| T |
20568353 |
cgtgagcttagctcagttggtaaggacattgcataatatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataaaggtgaattt |
20568254 |
T |
 |
| Q |
457 |
cta |
459 |
Q |
| |
|
||| |
|
|
| T |
20568253 |
cta |
20568251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 216209 - 216290
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||||||| | | |||| |||||||||||||||||||| ||||| |
|
|
| T |
216209 |
gtgagcttagctcaattggtagggatattgcatgttatatgcagggtctggggttcgaacctcggacaccccacttctccac |
216290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 3294766 - 3294842
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| |
|
|
| T |
3294766 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccactt |
3294842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 6530264 - 6530182
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| ||||||| || ||||| ||||| |||||| |||||||||| |
|
|
| T |
6530264 |
tatatgcaggggccggggttcaaacctcggacaccccacttattcaccttataaggtgaa-ttctagccactagactacttgac |
6530182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7545331 - 7545413
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||||| |||| ||||| || ||||||||||| ||||| |
|
|
| T |
7545331 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccccgaacaccccacttctccac |
7545413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9435628 - 9435710
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
9435628 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccac |
9435710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10934601 - 10934683
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10934601 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
10934683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17441907 - 17441825
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
17441907 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
17441825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19953896 - 19953814
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
19953896 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
19953814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 355 - 440
Target Start/End: Original strand, 743562 - 743647
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||||||| || ||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
743562 |
tctcgtgagcttagctcagttggtagggatattgcatattagatgcaggagccggggttcgaaccccggacactccacttctccac |
743647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 466
Target Start/End: Complemental strand, 14981799 - 14981691
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| ||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
14981799 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattcactttaaaa-gtgaattt |
14981701 |
T |
 |
| Q |
457 |
ctatccacta |
466 |
Q |
| |
|
||| |||||| |
|
|
| T |
14981700 |
ctagccacta |
14981691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 430
Target Start/End: Original strand, 1968998 - 1969070
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccc |
430 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||| ||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
1968998 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacacccc |
1969070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 32611620 - 32611540
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
32611540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 365 - 451
Target Start/End: Original strand, 5694923 - 5695009
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||| ||| |||| || ||||||| ||| |||||||||||| | |||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5694923 |
ttaggtcagttggtagggatattgtatattatatgcaggggtaggagtttgaacctcggacaccccacttctccacattaaaatgtg |
5695009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7207846 - 7207928
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||| || ||||| |
|
|
| T |
7207846 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccac |
7207928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 9064864 - 9064985
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| || |||||| |||||||| |
|
|
| T |
9064864 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatttactttaaaa-gtgaattt |
9064962 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
9064963 |
ctagccactaggctacctgacca |
9064985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9372269 - 9372187
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||| |||||| ||||| |
|
|
| T |
9372269 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac |
9372187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29284268 - 29284350
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||| |||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
29284268 |
cgtgagtttagctcagttggtagggatattgcatattatatgaaggggccggagttcgaaccccggacaccccacttctccac |
29284350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 30704962 - 30705044
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || |||||||||| |||||| |||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
30704962 |
cgtgagcttagttcagttggtagggatattgcatgttatatgtaggggccggggttcgaaccccggacaccccacttctccac |
30705044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31705901 - 31705983
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | |||||||||| ||||||| ||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
31705901 |
cgtgagcttagctcagttggtatggatattgcattatatatgtaggggtcggggttcgaaccacggacaccccacttctccac |
31705983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31802055 - 31802137
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
31802055 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
31802137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33573819 - 33573901
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
33573819 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccac |
33573901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 7234000 - 7234049
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7234000 |
tatatgcaggggctggggtttgaacctcggacaccccacttattcacctt |
7234049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19618796 - 19618712
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcata--atatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||| |||||| ||||||| | |||| ||||| |||||||||||||| ||||| |
|
|
| T |
19618796 |
cgtgagtttagctcaattggtagggatattgcatattatatatacaggggctggggttcgaaccccggacaccccacttctccac |
19618712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 28030867 - 28030948
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
28030867 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccctggacactccacttctccac |
28030948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 31104884 - 31104977
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||| ||| ||| || |||||| |||| ||||||||||||||| ||| ||| | |||||||||||||| ||||| |||||||||| |
|
|
| T |
31104884 |
cgtgagcttagttcagttgatagggatattacatattatatgcaggggccggagttcgaatcccggacaccccacttctccacattaaaatgtg |
31104977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 31935102 - 31935183
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || |||||||||| |||||||||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccac |
31935183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 2816894 - 2816974
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||| || |||||||||| ||||||||||||| | | || |||| |||||||||||||| ||||| |
|
|
| T |
2816894 |
tgagcttagctcaattggtagggatattgcatgttatatgcaggggctgagattcgaactccggacaccccacttctccac |
2816974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 30938390 - 30938510
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaattt |
456 |
Q |
| |
|
|||||||||| |||| |||| || || |||||||||||||||||||| ||| |||| ||||| | ||||||| |||||| | |||| |||| | |||||| |
|
|
| T |
30938390 |
cgtgagcttaactcagttggtagggacattgcataatatatgcagggaccggggttcgaaccccagacaccctacttattctccttgaaaaggagaattt |
30938489 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| ||||| |||| ||||| |
|
|
| T |
30938490 |
ctagacactaaactatttgac |
30938510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 3795835 - 3795760
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||||| ||||| |||||| ||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcagacactccacttctccac |
3795760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 433
Target Start/End: Complemental strand, 5052141 - 5052066
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact |
433 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||| |||||||||| | || |||||||||| ||||||| ||||| |
|
|
| T |
5052141 |
cgtgagcttagctcaattggtagggatatcgcattttatatgcaggagtcggggtttgaaccccggacactccact |
5052066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Original strand, 22983615 - 22983697
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| || |||| || ||||| ||||| ||||||| |||| |||| |
|
|
| T |
22983615 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaa-ttctaaccactatgctacgtgac |
22983697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 23804793 - 23804711
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| || |||| || ||||| ||||| ||||||| |||| |||| |
|
|
| T |
23804793 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaa-ttctaaccactatgctacgtgac |
23804711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 439
Target Start/End: Complemental strand, 32670120 - 32670041
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||| | |||| ||||| | ||||||| |||| |||| |
|
|
| T |
32670120 |
tgagcttagctcaattggtaggaatattgcataatttatgcaggggcaggggttcgaacccctgacaccctacttctcca |
32670041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 606989 - 607071
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||||||||| | || ||||||||||||| ||||||||| ||| |||| |||| || ||||||||||| ||||| |
|
|
| T |
606989 |
cgtgagcatagctcaattagtagggatattgcataatttatgcagggaccgaggttcgaactccgaacaccccacttctccac |
607071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 978202 - 978120
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| || | || ||||||||||| |||||||||||| || |||| |||| |||||||||||||| ||||| |
|
|
| T |
978202 |
cgtgagtttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacaccggacaccccacttctccac |
978120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 3448350 - 3448448
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| ||||||||||||||| || | ||||| | ||| |||||||||| |||| ||||| |||||||||||||||| || |||| || ||||||| |
|
|
| T |
3448350 |
cgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaatt |
3448448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3794241 - 3794159
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
3794241 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccac |
3794159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 432
Target Start/End: Original strand, 4408360 - 4408434
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||| |
|
|
| T |
4408360 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccacagacactccac |
4408434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6210056 - 6210138
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
6210056 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac |
6210138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7177297 - 7177379
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| || ||||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
7177297 |
cgtgagcttagctcagttggtagggatattgtattttatatgcaggggctggggttcgaaccccagacaccccacttctccac |
7177379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 7897187 - 7897105
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||| ||| |||| || |||| ||||||||||||||||||| || |||| ||||| |||||||||||||| |||| |
|
|
| T |
7897187 |
cgtgagcttagatcagttggtagggataaatgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctcca |
7897105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9246450 - 9246368
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
9246450 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccac |
9246368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10483604 - 10483522
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || |||||||||| |||||||||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10483604 |
cgtgatcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccac |
10483522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10517201 - 10517283
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | |||||||||| |||||||||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10517201 |
cgtgagcttagctcagttggtatggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccac |
10517283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 428
Target Start/End: Original strand, 16406571 - 16406641
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacc |
428 |
Q |
| |
|
||||||||||| |||||||| || ||||||| ||||| ||||||||||| | |||||||||| | |||||| |
|
|
| T |
16406571 |
cgtgagcttagttcaattggtagagatattgtataatttatgcaggggctggggtttgaaccccagacacc |
16406641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17454813 - 17454731
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
17454813 |
cgtgagcttatctcagttggtagagatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
17454731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 19279484 - 19279534
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19279484 |
tatatgcaggggccggagttcgaacctcggacaccccacttattcacctta |
19279534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19892344 - 19892262
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| |||||| ||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
19892344 |
cgtgagcttagttcagttggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacactccacttctccac |
19892262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 22997338 - 22997420
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||| ||||| || |||| ||||| ||||||||| |||| ||||| |
|
|
| T |
22997338 |
cgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccac |
22997420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23791063 - 23790981
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||| |||||| ||||| || |||| ||||| ||||||||| |||| ||||| |
|
|
| T |
23791063 |
cgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccac |
23790981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24319015 - 24319097
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||| ||| |||| || || |||||||||| ||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
24319015 |
cgtgagtttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacactccacttctccac |
24319097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 387 - 429
Target Start/End: Original strand, 32502215 - 32502257
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccc |
429 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
32502215 |
tgcataatatatgcaggggccgaggtttgaacctcagacaccc |
32502257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 5134494 - 5134433
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||| ||||| |||| ||||||| |||||||||||||| ||||||| || ||||||| |
|
|
| T |
5134494 |
tatatgcagaggccgcggttcgaacctcagacaccccacttattcaccttataaggtgaatt |
5134433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 6228355 - 6228278
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
6228355 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
6228278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 8857092 - 8857153
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||| ||||||||||||||| |||| ||||| |
|
|
| T |
8857092 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaacc |
8857153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 12089132 - 12089193
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
12089132 |
tatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaatt |
12089193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 18903462 - 18903385
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||||| | |||| | || ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
18903462 |
tgagcttagctcatttggcaagggataatacacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
18903385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 25020588 - 25020527
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
25020588 |
tatatgcaggggcctgggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
25020527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 28237322 - 28237237
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtgg-tttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| |||| || ||||||||||| |||||||||| |||| || |||||||| |||||| |||||| ||||| |
|
|
| T |
28237322 |
ctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccac |
28237237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 443
Target Start/End: Original strand, 32470712 - 32470769
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacacccc-acttatccacctt |
443 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| |||||||| |||||| |||||| |
|
|
| T |
32470712 |
tgcataatatatgcaggggctgaggtttgaacctcagacacccctacttattcacctt |
32470769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 439
Target Start/End: Original strand, 361166 - 361246
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| |||| | |||||||||||| |||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaactccagacaccccacttctcca |
361246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 418
Target Start/End: Complemental strand, 4869766 - 4869706
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaac |
418 |
Q |
| |
|
||||||||||||||| |||| || |||| |||||| ||||||||||||||| |||| |||| |
|
|
| T |
4869766 |
cgtgagcttagctcagttggtagggatactgcatattatatgcaggggccggggttcgaac |
4869706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 451
Target Start/End: Complemental strand, 11421053 - 11420962
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||| |||||| |||||| |||| ||| | |||||| ||| ||| ||||| || ||||||| |
|
|
| T |
11421053 |
gtgagcttagctcaactggcagggacattgcataatttatgca-gggccggggttcgaaacccggacatcccgcttctccacgtttaaatgtg |
11420962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 15964009 - 15963929
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| | ||||||||||| | |||| ||||| |||||| |||||| ||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcaggggctggggttcgaaccctggacactccacttctccac |
15963929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 364 - 440
Target Start/End: Complemental strand, 28148795 - 28148719
Alignment:
| Q |
364 |
cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| |||| || ||||||||||| |||||||||| |||| | || ||||| ||||||| |||||| ||||| |
|
|
| T |
28148795 |
cttagctcagttggtagggatattgcatattatatgcaggagccgggtttcgaaccccggacactccacttctccac |
28148719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 32813718 - 32813642
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||| ||| |||| | ||||||||||| ||||||||||||||| |||| ||||| |||| || |||||| |
|
|
| T |
32813718 |
cgtgagcttagttcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggatactccactt |
32813642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Original strand, 8439677 - 8439724
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg |
405 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| |
|
|
| T |
8439677 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
8439724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 359 - 477
Target Start/End: Original strand, 16119280 - 16119398
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt---aaaatgtgaatt |
455 |
Q |
| |
|
|||||| ||||||| ||||||| || || ||||||||||| ||||||||| |||| ||||| | ||||||| | |||| |||||| |||||||||| | |
|
|
| T |
16119280 |
gtgagcatagctcagttggcagggaaat-gcataatatattcaggggccggggttcgaacc-ctgacaccctatttattcaccttaaaaaaatgtgaa-t |
16119376 |
T |
 |
| Q |
456 |
tctatccactatactacttgac |
477 |
Q |
| |
|
|||| |||||| |||||||||| |
|
|
| T |
16119377 |
tctagccactagactacttgac |
16119398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 33646860 - 33646919
Alignment:
| Q |
382 |
gatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| | ||||||||||| || |||| |||||||||||||||||||| ||||| |
|
|
| T |
33646860 |
gatattgcatatttatatgcaggggtcggggttcgaacctcggacaccccacttctccac |
33646919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Original strand, 4844178 - 4844262
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
|||||||||||| || ||||| |||||| |||||| ||||||| |||||| |||| ||||| ||||| |||||| |||||||||| |
|
|
| T |
4844178 |
tatatgcaggggtcggggtttaaacctcagacacctcacttattcaccttgaaaaaagtgaa-ttctaaccactagactacttgac |
4844262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6419150 - 6419069
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||| |||| |||| || ||||||||||| ||||||||||| ||| |||| ||||| |||||| ||||||| ||||| |
|
|
| T |
6419150 |
cgtgagtttaactcagttggtagagatattgcatattatatgcagggtccggggttcgaacc-cggacaacccacttctccac |
6419069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 7153792 - 7153866
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||| |||| |||| || |||||||||| ||||||||||||||| |||| ||| | ||||||| |||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggggccgaggttcgaatcccggacactccactt |
7153866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 407
Target Start/End: Original strand, 7418279 - 7418329
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggcc |
407 |
Q |
| |
|
||||||||||| |||| |||| || ||||||||||| |||||||||||||| |
|
|
| T |
7418279 |
tcgtgagcttaactcatttggtagggatattgcatattatatgcaggggcc |
7418329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 9491795 - 9491745
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
|||||| |||||||| |||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
9491795 |
tatatgtaggggccggggttcgaaccccggacaccccacttattcacctta |
9491745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 10424595 - 10424545
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
|||||| ||||| ||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
10424595 |
tatatgtaggggtcgtggtttgaatcccggacaccccacttattcacctta |
10424545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10628616 - 10628698
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| ||||||| |||| || ||||||||||| ||||||||||||| | ||| |||| |||||||||| |||| ||||| |
|
|
| T |
10628616 |
cgtgagtttagctcggttggtagggatattgcatattatatgcaggggctggtgttcgaacatcggacaccctacttttccac |
10628698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 448
Target Start/End: Complemental strand, 22730762 - 22730708
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaat |
448 |
Q |
| |
|
||||||||||| | | ||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
22730762 |
tatatgcagggactgaagttcgaacctcggacaccccacttattcaccttaaaat |
22730708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 26528602 - 26528652
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||||||||| ||||||| |
|
|
| T |
26528602 |
tatatgcaggggtcggggttcaaacctcggacaccccacttattcacctta |
26528652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 27667198 - 27667244
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
27667198 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccac |
27667244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 30885638 - 30885556
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||| ||||||| | |||| ||||| | ||||| ||| || ||||| |
|
|
| T |
30885638 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggggctggggttcgaaccccagacactccatttctccac |
30885556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 3299035 - 3298954
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||| ||||||||||| || || |||||||| ||| ||||||| |||| |
|
|
| T |
3299035 |
cgtgagcttagatcaattggtagggatattgcatataatatgcaggggtcggaattcgaacctcgaacatcccacttctcca |
3298954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 4854401 - 4854324
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||||| | |||| || | ||| | ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
4854401 |
tgagcttagctcatttggcaagggataatgtacaatgtgtgcaggggccggggttcgaaccccggacaccccacttat |
4854324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 9704419 - 9704480
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |
|
|
| T |
9704419 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
9704480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 12101921 - 12101982
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||| |||||| ||||||| || ||||||| |
|
|
| T |
12101921 |
tatatgcaggggccggcgttcgaaccccggacaccctacttattcaccttataaggtgaatt |
12101982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 16251583 - 16251522
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| ||| ||| |||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
16251583 |
tatatgcaggggtcgttgttcgaactccggacaccccacttattcaccttataaggtgaatt |
16251522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 24256951 - 24257000
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| |||| ||||| |||| ||||||||||| |||||| |
|
|
| T |
24256951 |
tatatgcaggggccgaggttcgaaccccggataccccacttattcacctt |
24257000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 28222865 - 28222945
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||| |||| |||| |||| || ||||||||||| ||||||||| ||||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
28222865 |
cgtgaacttaactcagttggtagggatattgcatattatatgcagaggccggggttcgaacc-cggacactccacttctcca |
28222945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 32283541 - 32283622
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||||| || || |||||||||| |||||| ||| || |||| ||||| | ||||| ||||| ||||| |
|
|
| T |
32283541 |
gtgagcttagctcaattggtagggacattgcataatttatgcaagggtcggggttcgaaccccagacacttcacttttccac |
32283622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 51; Significance: 8e-20; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10894 - 10812
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
10894 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
10812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 8e-20; HSPs: 119)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9877335 - 9877253
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
9877335 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
9877253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23102626 - 23102544
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
23102626 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
23102544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 360 - 450
Target Start/End: Original strand, 27788273 - 27788363
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| | |||||||||||| ||||| || |||||| |
|
|
| T |
27788273 |
tgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgt |
27788363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 360 - 450
Target Start/End: Original strand, 27791429 - 27791519
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| | |||||||||||| ||||| || |||||| |
|
|
| T |
27791429 |
tgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgt |
27791519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 29658369 - 29658248
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| |||||||||||||||||| | ||||| | |||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||| || |
|
|
| T |
29658369 |
cgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaa-tt |
29658271 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| ||||||||||| |
|
|
| T |
29658270 |
ctagccactaggctacttgacca |
29658248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 27424841 - 27424923
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||||||||| || |||||| ||||| |
|
|
| T |
27424841 |
cgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaacctcggatactccacttctccac |
27424923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 15238891 - 15238972
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
15238891 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctcca |
15238972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 22774042 - 22774135
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||| ||||||||||| | |||| |||| |||||||||||||| ||||| || ||||||| |
|
|
| T |
22774042 |
cgtgagcttagctcaattgacagggacattgcataatttatgcaggggcaggggttcaaaccccggacaccccacttctccacatttaaatgtg |
22774135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 355 - 440
Target Start/End: Complemental strand, 30388578 - 30388493
Alignment:
| Q |
355 |
tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
30388578 |
tctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccac |
30388493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 466
Target Start/End: Original strand, 42352652 - 42352760
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc |
457 |
Q |
| |
|
||||||||| ||||| |||| || || ||||| ||||||||||||||||| |||||||||| ||||| |||||||||| | |||||||| | |||||| |
|
|
| T |
42352652 |
cgtgagctttgctcagttggtagggacattgcctaatatatgcaggggccagggtttgaaccccggacgccccacttattctccttaaaaagagaattta |
42352751 |
T |
 |
| Q |
458 |
tatccacta |
466 |
Q |
| |
|
|| |||||| |
|
|
| T |
42352752 |
tagccacta |
42352760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 358 - 472
Target Start/End: Complemental strand, 31475937 - 31475823
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || ||||||| || |||||||||||| | |||| ||||| | |||||||||||||| ||| |||||| |||||||| |
|
|
| T |
31475937 |
cgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttattcactttaaaa-gtgaattt |
31475839 |
T |
 |
| Q |
457 |
ctatccactatactac |
472 |
Q |
| |
|
||| |||||| ||||| |
|
|
| T |
31475838 |
ctagccactagactac |
31475823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2228977 - 2229059
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| ||||| |||| || |||||||||| ||||| |
|
|
| T |
2228977 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttaaaccccgagcaccccacttctccac |
2229059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9712266 - 9712184
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
9712266 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac |
9712184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10244957 - 10244875
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||| |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
10244957 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacaccccacttctccac |
10244875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19753036 - 19752954
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
19753036 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccac |
19752954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29617407 - 29617489
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
29617407 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
29617489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36174392 - 36174474
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
36174392 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttttccac |
36174474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 475
Target Start/End: Original strand, 8859716 - 8859833
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaat-gtgaatttc |
457 |
Q |
| |
|
||||||||| ||||||||| || || ||| ||||||||||||||||| || ||| | ||||| ||||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
8859716 |
gtgagcttaactcaattggtagggaaattacataatatatgcaggggtcgatgttcgtacctcaaacacctcacttattcaccttaaaatggtgaatttc |
8859815 |
T |
 |
| Q |
458 |
tatccactatactacttg |
475 |
Q |
| |
|
|| |||||| ||||||| |
|
|
| T |
8859816 |
tagccactaggctacttg |
8859833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 14102496 - 14102557
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
14102496 |
tatatgcaggggccggggtttgaaccccggacaccccacttattcaccttataaggtgaatt |
14102557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 14412513 - 14412574
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
14412513 |
tatatgcaggggccggggtttgaaccccggacaccccacttattcaccttataaggtgaatt |
14412574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 48119473 - 48119554
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
48119473 |
gtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccac |
48119554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 475
Target Start/End: Complemental strand, 8858777 - 8858661
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa-tgtgaatttct |
458 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||| || || || |||| | |||||| ||||| || |||| | |||||||| |||||||||| |
|
|
| T |
8858777 |
tgagcttagctcaattggcagggacattacataatatatgaagaggtcgaggttcgtacctcgaacacctcagttattccccttaaaagggtgaatttct |
8858678 |
T |
 |
| Q |
459 |
atccactatactacttg |
475 |
Q |
| |
|
| |||||| |||||||| |
|
|
| T |
8858677 |
agccactagactacttg |
8858661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 359 - 427
Target Start/End: Complemental strand, 13730164 - 13730096
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
|||||||||||| | |||| || ||||||||||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatgcaggggccggggtttgaaccccggacac |
13730096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 28805304 - 28805384
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| ||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcaggggtcggggttagaaccccggacaccccacttctccac |
28805384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 32677008 - 32676928
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
32676928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 365 - 440
Target Start/End: Original strand, 9497975 - 9498050
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||| ||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
9497975 |
ttagctcaattggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacaccccacttctccac |
9498050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 353 - 479
Target Start/End: Complemental strand, 22966059 - 22965934
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||| ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| ||||||| || ||| |
|
|
| T |
22966059 |
agtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtg |
22965961 |
T |
 |
| Q |
452 |
aatttctatccactatactacttgacca |
479 |
Q |
| |
|
|| ||||| |||||| ||||| |||||| |
|
|
| T |
22965960 |
aa-ttctaaccactagactacatgacca |
22965934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 360 - 458
Target Start/End: Original strand, 27454011 - 27454110
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttct |
458 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||| | |||||||| || |||| |||||||||||||||||||||| || ||||||| |||||||||| |
|
|
| T |
27454011 |
tgagcttagctcatttggtaagggataatgcacaatttgtgcaggggtcgaggttcgaacctcggacaccccacttattcatcttaaaaggtgaatttct |
27454110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 358 - 444
Target Start/End: Complemental strand, 36316070 - 36315984
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||| ||||||| |||| || |||| ||||| || |||||||||||||| |||| |||||||||||||||||||||| ||||||| |
|
|
| T |
36316070 |
cgtgagcatagctcagttggtag-gataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcacctta |
36315984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 36931976 - 36932051
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||| ||||||||| ||||||| || |||||||||| ||||||||| ||| |||| ||||| |||||||||||||| |
|
|
| T |
36931976 |
gtgaacttagctcagttggcagggacattgcataatttatgcagggtccggggttcgaaccccggacaccccactt |
36932051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 368 - 434
Target Start/End: Complemental strand, 1563797 - 1563731
Alignment:
| Q |
368 |
gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
1563731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3766813 - 3766895
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
3766813 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
3766895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 12640657 - 12640575
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
12640657 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccac |
12640575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 21285450 - 21285352
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| | |||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
21285450 |
cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
21285352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24781032 - 24781114
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| ||||| |
|
|
| T |
24781032 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccac |
24781114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 25711191 - 25711106
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta-aaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||||||||||||| ||| ||| ||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
25711191 |
tatatgtaggggccggggttcgaacctcggacaccccacttattcactttataaatgtgaa-ttctatccactaggctatttgacca |
25711106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31026221 - 31026303
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
31026221 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
31026303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 35950130 - 35950212
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
35950130 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
35950212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36391972 - 36391890
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
36391972 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
36391890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 41331147 - 41331065
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||| |||||||||| || |||| ||| |||||||||||||| ||||| |
|
|
| T |
41331147 |
cgtgagcttagctcagttggcagggacattgcataatttatgcaggggtcggggttcgaattccggacaccccacttctccac |
41331065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42443691 - 42443773
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
42443691 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac |
42443773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 4169111 - 4169172
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||| |||||| |||||||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
4169111 |
tatatgcaagggccggggtttgaaccccggacaccccacttattcaccttataaagtgaatt |
4169172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 23755082 - 23755001
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||||| || || ||||||||||| | ||||||||||| | | || ||||||| |||||||||||| |||| |
|
|
| T |
23755082 |
cgtgagcttagctcaatcggtagggatattgcatattttatgcaggggctgagattcgaacctcagacaccccacttctcca |
23755001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 37411804 - 37411723
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||||||| || || |||||||||| |||||||||| || |||||||| |||||||||||||| ||||| |
|
|
| T |
37411804 |
gtgagtttagctcaattggtagggacattgcataatttatgcaggggtcggagtttgaactccggacaccccacttctccac |
37411723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 393 - 466
Target Start/End: Original strand, 47225195 - 47225268
Alignment:
| Q |
393 |
atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
47225195 |
atatatgcaggggccggcgttcgaacctcggactccccacttatttcccttaaaaggtgaatttctagccacta |
47225268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 48413993 - 48413912
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||| || | | || |||| ||||||| |||||| ||||| |
|
|
| T |
48413993 |
gtgagcttagctcaattggcagagatattgcatattatatgcaggagctgagattcgaactccggacactccacttctccac |
48413912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 35612633 - 35612553
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||||||||| || | |||||||||| ||||||| |||||| ||||| |
|
|
| T |
35612633 |
tgagcttagctcaattggtagggagattgcatattatatgcagaggttggggtttgaaccccggacactccacttctccac |
35612553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 356 - 419
Target Start/End: Original strand, 3532578 - 3532641
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||| ||||| ||| |||| || ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
3532578 |
ctcgtgatcttagttcagttggtagggatattgcataatatatgcaggggccgaggttcgaacc |
3532641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 356 - 439
Target Start/End: Original strand, 12772115 - 12772198
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| |||| || |||||| |||| |
|
|
| T |
12772115 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggatactccacttctcca |
12772198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 1398947 - 1398889
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||| | |||||||||||||| ||||| |
|
|
| T |
1398947 |
gatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccac |
1398889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2681098 - 2681180
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| || ||| ||||| |
|
|
| T |
2681098 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccccttctccac |
2681180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 450
Target Start/End: Complemental strand, 15716751 - 15716661
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt |
450 |
Q |
| |
|
|||| |||||||| |||| || |||||||| || |||||||| ||| || |||| |||| ||||||||||||||||| ||| || |||||| |
|
|
| T |
15716751 |
tgagtttagctcagttggtagggatattgcgtattatatgcaagggtcggggttcgaacttcggacaccccacttattcacatttaaatgt |
15716661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 21066888 - 21066970
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||| | ||||| ||||| |
|
|
| T |
21066888 |
cgtgagtttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacatctcacttctccac |
21066970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23274882 - 23274800
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || || |||||||||| ||||||||||||| ||| ||||| ||||||||||| || ||||| |
|
|
| T |
23274882 |
cgtgagcttagctaagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccatttttccac |
23274800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 24061397 - 24061315
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| |||||||||| |||| |||| ||||| || |||| |||||| ||||| |
|
|
| T |
24061397 |
cgtgagcttagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccac |
24061315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24188472 - 24188554
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || |||| |||||| |||||||||||| || |||| ||||| | |||||||||||| ||||| |
|
|
| T |
24188472 |
cgtgagcatagctcagttggtagggatactgcatattatatgcaggggtcggggttcgaaccccagacaccccacttctccac |
24188554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 25833557 - 25833639
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | || || |||||| ||||| |
|
|
| T |
25833557 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccac |
25833639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 27047775 - 27047725
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
27047775 |
tatatgcaggggccggggttcgaacctcggacaccccatttattcacctta |
27047725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 28444150 - 28444068
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||| |||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
28444150 |
cgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccac |
28444068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 30806117 - 30806199
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||||| || ||| ||||| |||||| ||||||| ||||| |
|
|
| T |
30806117 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaaccccggacatcccacttctccac |
30806199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 30940773 - 30940855
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||| ||||| |||| ||| | || |||| |||||| ||||| |
|
|
| T |
30940773 |
cgtgagcttagctcagttggtagtgatattgcatattatatgcagaggccggggttcgaatcccgaacacaccacttctccac |
30940855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 436
Target Start/End: Original strand, 38378242 - 38378296
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
|||| |||| ||||| ||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
38378242 |
gataatgcacaatatgtgcaggggccggggtttgaaccccggacaccccacttat |
38378296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 41417372 - 41417251
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| | | ||||| || ||||||||||| || |||| ||||| | |||||||||||||| ||| |||||| |||||||| |
|
|
| T |
41417372 |
cgtgagcatagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaa-gtgaattt |
41417274 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
|| ||| || |||||||||||| |
|
|
| T |
41417273 |
ttagccattagactacttgacca |
41417251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 41465840 - 41465918
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||||||| |||||||||||| | |||| |||| |||||||||||||| ||||| |
|
|
| T |
41465840 |
agcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacaccccacttctccac |
41465918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 41853999 - 41854081
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||| |||||||||| || ||| |||| |||||||||| ||| ||||| |
|
|
| T |
41853999 |
cgtgagcttagctcagttggcagggacattgcataatttatgcaggggacggagttcaaaccccggacaccccgcttctccac |
41854081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 44616604 - 44616686
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| || | ||||||| |||||| ||||| |
|
|
| T |
44616604 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcaaaacccggacactccacttctccac |
44616686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 47463933 - 47464015
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||| |||||||||||| | |||| |||||||||||||||||||| ||||| |
|
|
| T |
47463933 |
cgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggttggggttcgaacctcggacaccccacttctccac |
47464015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 47641047 - 47641129
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| |||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
47641047 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggctggggttcgaaccccagacactccacttctccac |
47641129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 5787496 - 5787557
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||||||||| | ||||||||||||| ||||||| || ||||||| |
|
|
| T |
5787496 |
tatatgcaggggccggggtttgaaccccaaacaccccacttattcaccttataaggtgaatt |
5787557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 16200562 - 16200643
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||||| || |||||||||| |||||||||||| || |||| ||||| | ||||||||| || ||||| |
|
|
| T |
16200562 |
gtgagcttagcttaattggtaggaatattgcatattatatgcaggggtcggggttcgaaccccagacaccccatttctccac |
16200643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 363 - 440
Target Start/End: Complemental strand, 18503543 - 18503466
Alignment:
| Q |
363 |
gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
18503543 |
gcttagctcggttggaagagatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccac |
18503466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 36469773 - 36469692
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||| || ||||||| |||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
36469773 |
cgtgagcttagctcagttggtagggatattacatattacatgcaggagccggggttcgaaccccggacactccacttctcca |
36469692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 37300167 - 37300106
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| |||||||| ||||||||| |
|
|
| T |
37300167 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggagtttgaacc |
37300106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 38151347 - 38151428
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || |||||||||| || |||||||||| || |||| ||||| | ||||||||||| ||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcattatttatgcaggggtcggggttcgaaccatgaacaccccacttctccac |
38151428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 38451898 - 38451982
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| |||| ||| | |||||||||||||||| ||| ||| || ||||| ||||| |||||| ||||| |||||| |
|
|
| T |
38451898 |
tatatgcaggggccggggttcgaatcccggacaccccacttattcacattataaggtgaa-ttctagccactagactacctgacca |
38451982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 40273821 - 40273898
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
40273821 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
40273898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 41084041 - 41084102
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| |
|
|
| T |
41084041 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacc |
41084102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 427
Target Start/End: Complemental strand, 47255150 - 47255081
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||| ||| |||||| |||| |||| ||||| ||||||| |
|
|
| T |
47255150 |
cgtgagcttaactcagttggcagagatattgcatattatctgcaggagccggggttcgaaccccggacac |
47255081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 432
Target Start/End: Original strand, 21388527 - 21388599
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||| |
|
|
| T |
21388527 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
21388599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 395 - 455
Target Start/End: Original strand, 34948142 - 34948202
Alignment:
| Q |
395 |
atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||| ||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
34948142 |
atatgcagtggccgaggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
34948202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 41139085 - 41139204
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || ||||||||||| || |||| ||| | ||||||| ||||||| ||| |||||| |||||||| |
|
|
| T |
41139085 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaatcccggacacttcacttattcactttaaaa-gtgaattt |
41139183 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| |||||| ||||||||| |
|
|
| T |
41139184 |
ctagccactaggctacttgac |
41139204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 45284887 - 45284811
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| ||| || || |||| ||||| |||||||||| || |||| ||||| |||||||||||||| |
|
|
| T |
45284887 |
cgtgagcttagctcagttgatagggacattgaataatttatgcaggggtcggggttcgaaccccggacaccccactt |
45284811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 48447749 - 48447833
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| |||| || ||||| |||| ||||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
48447749 |
ctcgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccggggttcgaaccccagacactccacttctccac |
48447833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 373 - 440
Target Start/End: Original strand, 10646182 - 10646249
Alignment:
| Q |
373 |
attggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| || ||||||||||| | |||||| ||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
10646182 |
attggtagggatattgcatattttatgcaagggtaggggtttgaacctcggacaccccacttctccac |
10646249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 444
Target Start/End: Original strand, 11808037 - 11808123
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
|||||||||||||||||||| || || || |||| | ||||||||||| || |||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
11808037 |
cgtgagcttagctcaattggtagggacat-gcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctta |
11808123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 474
Target Start/End: Complemental strand, 21461746 - 21461631
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttct |
458 |
Q |
| |
|
||||||||||||| ||| || || | |||||||| |||||| ||| || |||| ||| |||||||| ||||||||| ||| || |||| |||||||| | |
|
|
| T |
21461746 |
tgagcttagctcagctggtagggacaatgcataatttatgcaagggtcggggttcgaatctcggacatcccacttattcactttaaaaaggtgaatttat |
21461647 |
T |
 |
| Q |
459 |
atccactatactactt |
474 |
Q |
| |
|
| |||||| ||||||| |
|
|
| T |
21461646 |
aaccactagactactt |
21461631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Complemental strand, 27510325 - 27510270
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt |
413 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| |
|
|
| T |
27510325 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggtt |
27510270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Original strand, 36622176 - 36622231
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt |
413 |
Q |
| |
|
||||| |||||||||||||| || ||||||||||| |||||||| |||||| |||| |
|
|
| T |
36622176 |
cgtgaacttagctcaattggtagggatattgcatattatatgcatgggccggggtt |
36622231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 446
Target Start/End: Complemental strand, 47440849 - 47440790
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa |
446 |
Q |
| |
|
||||||||||||||||||| || |||| ||||| ||||||||||||| ||||| ||||| |
|
|
| T |
47440849 |
tgcataatatatgcaggggtcggggttcgaaccctggacaccccacttctccacattaaa |
47440790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 2261580 - 2261483
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||| | ||||||||| |||||| ||||||| || ||||||| |
|
|
| T |
2261580 |
cgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccggggttcgaatcccggacacccaacttattcaccttataaggtgaatt |
2261483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 412 - 477
Target Start/End: Original strand, 3948107 - 3948173
Alignment:
| Q |
412 |
tttgaacctcggacaccccacttatccacctta-aaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||| || |||||||| ||||||| || |||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
3948107 |
tttgagccccggacacctcacttattcatcttataaatgtgaatttctagccactaaactacttgac |
3948173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 435
Target Start/End: Original strand, 7465465 - 7465542
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccactta |
435 |
Q |
| |
|
||||||| ||||||| ||||||| || || |||| || |||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
7465465 |
cgtgagcatagctcagttggcagagacat-gcattattatatgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 365 - 439
Target Start/End: Original strand, 13720779 - 13720853
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||| |||| | ||||||||||| ||||||||||||||| |||| ||||| || |||| |||||| |||| |
|
|
| T |
13720779 |
ttagctcagttggttgggatattgcatattatatgcaggggccggggttcgaaccccgaacactccacttctcca |
13720853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 14204298 - 14204356
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||||| |||||| | |||| ||||||||||||| |||||| ||||| |
|
|
| T |
14204298 |
gatattgcatattatatgtaggggctggggttcgaacctcggacactccacttctccac |
14204356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 24880516 - 24880438
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||| || |||| |||||| ||||| |
|
|
| T |
24880516 |
agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccgaacactccacttctccac |
24880438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 27907956 - 27907894
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||| || |||| || |||||||| |
|
|
| T |
27907956 |
tatatgcaggggccggggtaagaatctcggacaccccacttattcatcttataaggtgaattt |
27907894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 353 - 435
Target Start/End: Complemental strand, 28479401 - 28479319
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactta |
435 |
Q |
| |
|
|||| ||||| |||| |||||||| ||| ||||||||||| |||||| | | |||| ||||||||| | ||||||||||||| |
|
|
| T |
28479401 |
agtcacgtgaacttaactcaattgacagggatattgcatattatatgaaagagccggagtttgaaccccagacaccccactta |
28479319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 31762002 - 31762056
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt |
413 |
Q |
| |
|
||||| ||||||||||||| || |||||||||| ||||||| |||||| |||||| |
|
|
| T |
31762002 |
gtgagtttagctcaattggtagggatattgcatgatatatgtaggggctgtggtt |
31762056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 32047115 - 32047173
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
32047115 |
gatattgcatgttatatgcaggggccggggttcgaaccccggacacctcacttctccac |
32047173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 32074463 - 32074381
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| ||| ||||||||||||| | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
32074463 |
cgtgagcttagctcagttggtagggatatcacattttatatgcaggggctggggttcgaaccccggacactccacttctccac |
32074381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 32856985 - 32856903
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||| |||||| || ||||||||||| ||||||||||||| | ||| ||||| | ||||| |||||| ||||| |
|
|
| T |
32856985 |
cgtgaacttagcttaattggtagggatattgcatattatatgcaggggctgaagttcgaaccccagacactccacttctccac |
32856903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34267619 - 34267537
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| |||||||||| || | |||| ||||| ||||||| ||||| ||||| |
|
|
| T |
34267619 |
cgtgagcttagctcagttggtaggaatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccac |
34267537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 35683195 - 35683113
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| |||||||||||| || |||| |||| ||||||| |||||| ||||| |
|
|
| T |
35683195 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccacttctccac |
35683113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 38889561 - 38889479
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| ||||||||||||| | |||| | ||| | ||||| |||||| ||||| |
|
|
| T |
38889561 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggctgaggttcgtaccccagacactccacttctccac |
38889479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 370 - 440
Target Start/End: Complemental strand, 39956457 - 39956387
Alignment:
| Q |
370 |
tcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| || |||||||||||| |||||| |||| ||||| ||||||| |||||||||||| ||||| |
|
|
| T |
39956457 |
tcaattggtaggaatattgcataatttatgcaagggcaatggttcgaacctctgacaccccacttctccac |
39956387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 472
Target Start/End: Original strand, 42887189 - 42887266
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac |
472 |
Q |
| |
|
||||||||||||| | |||| ||||| |||||||||||||||| |||||| || ||||| ||||| |||||| ||||| |
|
|
| T |
42887189 |
tatatgcaggggctgaggttcgaaccccggacaccccacttatttaccttataaggtgaa-ttctagccactagactac |
42887266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Complemental strand, 44437885 - 44437843
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
44437885 |
tatatgcaggggccggggttcgaaccccggacaccccacttat |
44437843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 48288469 - 48288395
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||| |
|
|
| T |
48288469 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaatcccggacactccac |
48288395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 15106758 - 15106677
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
15106758 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccac |
15106677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 17900939 - 17900855
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
||||||||||||||| || | ||||| ||||| |||||||||| | ||||| || ||||| ||||| |||||| ||||||||||| |
|
|
| T |
17900939 |
tatatgcaggggccggggctcgaaccccggactccccacttattctccttataaggtgaa-ttctagccactaggctacttgacca |
17900855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 459
Target Start/End: Original strand, 19126772 - 19126836
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta |
459 |
Q |
| |
|
||||| ||||||| | |||| ||||| |||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
19126772 |
tatatacaggggctgaggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttcta |
19126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 27425117 - 27425166
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||| ||||||||| |||| |
|
|
| T |
27425117 |
attgcataatttatgcaggggcagtggttcgaaccccggacacccgactt |
27425166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 446
Target Start/End: Complemental strand, 28914950 - 28914885
Alignment:
| Q |
382 |
gatattgcataatatatgcagggg-ccgtggtttgaacctcggacaccccacttatccaccttaaa |
446 |
Q |
| |
|
|||| |||||| |||||||||||| ||| |||| ||||| |||||||||||||||| ||| ||||| |
|
|
| T |
28914950 |
gataatgcatattatatgcagggggccggggttcgaaccccggacaccccacttattcactttaaa |
28914885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 30644204 - 30644265
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| ||||| | |||||||||||||| ||||||| || ||||||| |
|
|
| T |
30644204 |
tatatgcaggggccggtgttcgaaccccagacaccccacttattcaccttataaggtgaatt |
30644265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 33202614 - 33202553
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||| ||||||||| |||| ||||| |||||||||||||||| || |||| || ||||||| |
|
|
| T |
33202614 |
tatatacaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaatt |
33202553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 37449570 - 37449509
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||||||||| ||||| ||||||||| ||| |||||| ||||||| |
|
|
| T |
37449570 |
tatatgcaggggtcggagtttgaaccttggacatcccacttattcactttaaaaagtgaatt |
37449509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 45011718 - 45011657
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||| |||| |||| |||||||||| ||||||||||| ||||||| || ||||||| |
|
|
| T |
45011718 |
tatatgcagaggccagggttcgaacctcggagaccccacttattcaccttataaggtgaatt |
45011657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 47999782 - 47999863
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||| || | |||| ||| | ||||||| |||||| |||| |
|
|
| T |
47999782 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggagctggggttcgaatcccggacactccacttctcca |
47999863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 48433805 - 48433728
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
48433805 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcaaaccccggacaccccacttat |
48433728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 8e-20; HSPs: 106)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 1844823 - 1844901
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
1844823 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacctcggacaccccacttctccac |
1844901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 459
Target Start/End: Original strand, 23405198 - 23405300
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| |||| || || ||||||||||||||||||||| || |||| ||||| ||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
23405198 |
cgtgagcttagctcagttggtagggacattgcataatatatgcaggggtcggggttcgaaccctggacaccccacttattcaccttaaaaaggtgaattt |
23405297 |
T |
 |
| Q |
457 |
cta |
459 |
Q |
| |
|
||| |
|
|
| T |
23405298 |
cta |
23405300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33229001 - 33228919
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
33229001 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
33228919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 5612957 - 5613038
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||| |||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccac |
5613038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 358 - 476
Target Start/End: Original strand, 29034974 - 29035092
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
29034974 |
cgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
29035072 |
T |
 |
| Q |
457 |
ctatccactatactacttga |
476 |
Q |
| |
|
||| |||||| |||||||| |
|
|
| T |
29035073 |
ctagccactaggctacttga |
29035092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 356 - 439
Target Start/End: Complemental strand, 44857304 - 44857221
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
44857304 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccacttctcca |
44857221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3446732 - 3446814
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
3446732 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac |
3446814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 20919612 - 20919694
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||||||||| ||||| ||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
20919612 |
cgtgagcttagctcagttggtagggacattgcataatttatgctggggccggggttcgaaccccggacaccccacttctccac |
20919694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34613981 - 34614063
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| | |||| ||||| |
|
|
| T |
34613981 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactctacttctccac |
34614063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40473618 - 40473536
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||| ||||||||||||| | ||||||||||||||||||||||||| ||||| |
|
|
| T |
40473618 |
cgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggctggggtttgaacctcggacaccccacttctccac |
40473536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40535517 - 40535435
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
40535517 |
cgtgagcttagctcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccac |
40535435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 41509518 - 41509600
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
41509518 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
41509600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 1964355 - 1964436
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||| ||||||| ||||||||| || |||||||||| ||||||||||||| |||| |||| |||||||||||||| |||| |
|
|
| T |
1964355 |
cgtgaacttagcttaattggcagggacattgcataatttatgcaggggccggggttcaaaccccggacaccccacttctcca |
1964436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 3287123 - 3287042
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||| || |||||| ||||| |
|
|
| T |
3287123 |
gtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttctccac |
3287042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 44666413 - 44666329
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||||||||||||||| || |||| ||||| |||||| |||||| ||||| |
|
|
| T |
44666413 |
ctcgtgagtttagctcaattgacagggatattgcataatatatgcagggatcggggttcgaaccccggacattccacttctccac |
44666329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 3596255 - 3596334
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| | ||||||| || |||||||||| |||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
3596255 |
gagcttagcttagttggcagagacattgcataatttatgcaggggtcggggttcgaaccccggacaccccacttctccac |
3596334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2643699 - 2643781
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
2643699 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
2643781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4562820 - 4562738
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
4562820 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
4562738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4878211 - 4878293
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||| ||| |||||| ||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
4878211 |
cgtgagtttagctcacttggcagggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccac |
4878293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 5521288 - 5521206
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| ||||||||||||||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
5521288 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgaggttcgaaccctggacactccacttttccac |
5521206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 15233415 - 15233465
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg |
408 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
15233415 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggccg |
15233465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17034737 - 17034819
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||| | || |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
17034737 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggagtcggggttcgaatcccggacactccacttctccac |
17034819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19281610 - 19281692
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
19281610 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac |
19281692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22653712 - 22653630
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
22653712 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
22653630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36182644 - 36182726
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccggacactccacttctccac |
36182726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 44187702 - 44187823
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||| ||| ||||||| |||| ||||| || ||||||||||| || |||| ||||| | |||||||||||||| ||| |||||| |||||||| |
|
|
| T |
44187702 |
cgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaa-gtgaattt |
44187800 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
|| |||||| ||||| |||||| |
|
|
| T |
44187801 |
ttagccactaaactacctgacca |
44187823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 3037682 - 3037621
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
3037682 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
3037621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 8250369 - 8250308
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
8250369 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacc |
8250308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 11050825 - 11050744
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || |||||| |||| ||||||||||||| | |||| |||| |||||||||||||| |||| |
|
|
| T |
11050825 |
cgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaactccggacaccccacttctcca |
11050744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 430
Target Start/End: Original strand, 5474908 - 5474980
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccc |
430 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||| ||||| |||| |||| |||| |||||||||| |
|
|
| T |
5474908 |
cgtgagcttagctcagttggcagggatattgcatattatacgcaggagccggggttcgaactccggacacccc |
5474980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 13242801 - 13242717
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||| ||| ||| || ||||||||||||| |||||||||| || |||| |||||||||||||| ||||| ||||| |
|
|
| T |
13242801 |
ctcgtgaacttagatcagttgatagagatattgcataatttatgcaggggtcggggttcgaacctcggacacctcacttctccac |
13242717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 28194636 - 28194716
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| ||| || ||||||||||| ||||||||||||| | ||| ||||| |||||||||||||| ||||| |
|
|
| T |
28194636 |
tgagcttagctcagttgctagggatattgcatattatatgcaggggctggagttcgaaccccggacaccccacttctccac |
28194716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 31223624 - 31223704
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| ||| |||| || ||||||||||| ||||||||||||| | |||||||||| | ||||| |||||| ||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgcaggggctggggtttgaaccccagacactccacttctccac |
31223704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 395 - 455
Target Start/End: Complemental strand, 34018129 - 34018069
Alignment:
| Q |
395 |
atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
34018129 |
atatgcaggggctggggttcgaacctcggacaccccacttattcaccttataaggtgaatt |
34018069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 35367415 - 35367495
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| ||| | ||||||||||| ||||| || |||||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
35367415 |
tgagcttagctcagttgataatgatattgcatattatatacaagggccgaggttcgaaccccggacaccccacttatccac |
35367495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 36665465 - 36665536
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| || ||| || ||||| |||||||||||| |
|
|
| T |
36665465 |
tatatgcaggggccggggttcgaacctcggacaccccacttattcattttataaggtgaa-ttctatccacta |
36665536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 356 - 439
Target Start/End: Complemental strand, 28195204 - 28195121
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||| |||| | |||| |||| |||| ||||||||| |||| |
|
|
| T |
28195204 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcaagggcaggggttctaaccccggataccccacttctcca |
28195121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 30390430 - 30390355
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||||| |||| ||||| |
|
|
| T |
30390430 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccctacttctccac |
30390355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 580843 - 580793
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
580843 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
580793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 1071472 - 1071554
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | ||||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
1071472 |
cgtgagcttagctcagttggtatggatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
1071554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 2304288 - 2304409
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||||||||||| ||||||| || | || || || ||||| ||||| || |||| ||||| |||||||||||||||| || |||||| |||||||| |
|
|
| T |
2304288 |
cgtgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatttactttaaaa-gtgaattt |
2304386 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
2304387 |
ctaaccactaggctacctgacca |
2304409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3438950 - 3439032
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
3438950 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
3439032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4183178 - 4183260
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
4183178 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccgaacactccacttctccac |
4183260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6331564 - 6331645
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6331564 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctccac |
6331645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 17154684 - 17154734
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta |
444 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
17154684 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcacctta |
17154734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 18278485 - 18278403
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
18278485 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac |
18278403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 20296420 - 20296502
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
20296420 |
cgtgagcttagctcagttgataaggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
20296502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25857363 - 25857281
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||| ||||||| |||||| ||||| |
|
|
| T |
25857363 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacaccggacactccacttctccac |
25857281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 404
Target Start/End: Complemental strand, 27913537 - 27913491
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggg |
404 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
27913537 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggg |
27913491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 32221005 - 32221051
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
32221005 |
tatatgcaggggccggggttcgaacctcggacaccccacttttccac |
32221051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36005444 - 36005526
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| || ||||||||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
36005444 |
cgtgagcgtaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccac |
36005526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 38400312 - 38400362
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg |
408 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |
|
|
| T |
38400312 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccg |
38400362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 44186469 - 44186527
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||| ||||||||| ||| |||||| |||||||||||||||||||| ||||| |
|
|
| T |
44186469 |
gatattacatattatatgcagcggctgtggttcgaacctcggacaccccacttctccac |
44186527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 3179359 - 3179420
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||||| |||||||||||||| ||||||| || ||||||| |
|
|
| T |
3179359 |
tatatgcaggggtcgaggttcgaacctcagacaccccacttattcaccttataaggtgaatt |
3179420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 8234852 - 8234791
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||| |||||||| |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
8234852 |
tatatgtaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
8234791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 11133111 - 11133172
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
11133111 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
11133172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 405
Target Start/End: Original strand, 15764930 - 15764979
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcagggg |
405 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||||||| |
|
|
| T |
15764930 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcagggg |
15764979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 30474255 - 30474194
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| | |||||||||||||| ||||||| || ||||||| |
|
|
| T |
30474255 |
tatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
30474194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 361 - 434
Target Start/End: Complemental strand, 32190067 - 32189994
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||| ||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||| ||||| |
|
|
| T |
32190067 |
gagcttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcactt |
32189994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 32527166 - 32527070
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatcc |
462 |
Q |
| |
|
||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| | |||| ||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
32527166 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttattcactttaaaa-gtgaatttctatcc |
32527070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 436
Target Start/End: Complemental strand, 33482709 - 33482660
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
33482709 |
tgcacaatatatgcagggaccgtggttcgaacctcagacaccccacttat |
33482660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 432
Target Start/End: Complemental strand, 38179312 - 38179239
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||| |||||||| |||| || |||||||||| ||||||||||||| | |||| ||||||||||||| |||| |
|
|
| T |
38179312 |
gtgagtttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaacctcggacactccac |
38179239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 44721764 - 44721703
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||||| |||| ||||||| || ||||||| |
|
|
| T |
44721764 |
tatatgcaggggtcggggttcgaacctcggacaccccatttattcaccttataaggtgaatt |
44721703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 44948598 - 44948659
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||| ||| |||| ||||| |
|
|
| T |
44948598 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaacc |
44948659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 427
Target Start/End: Complemental strand, 6636034 - 6635966
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||||||||||| | | |||| ||||| ||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgcagggacgggggttcgaaccccggacac |
6635966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 353 - 472
Target Start/End: Complemental strand, 22297553 - 22297435
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||| ||||||| |||| || || | ||||| || |||||||||||| | |||| ||||| ||||||||||| |||| ||||||| ||||| |
|
|
| T |
22297553 |
agtctcgtgagcatagctcagttggtag-gacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttattcaccttataatgtt |
22297455 |
T |
 |
| Q |
452 |
aatttctatccactatactac |
472 |
Q |
| |
|
|| ||||| |||||| ||||| |
|
|
| T |
22297454 |
aa-ttctagccactaaactac |
22297435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 433
Target Start/End: Original strand, 24202148 - 24202224
Alignment:
| Q |
358 |
cgtgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact |
433 |
Q |
| |
|
||||||||||||||| |||| | | |||| ||||| || ||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
24202148 |
cgtgagcttagctcacttggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacaccccact |
24202224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 362 - 406
Target Start/End: Complemental strand, 24581528 - 24581484
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggc |
406 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
24581528 |
agcttaactcagttggcagggatattgcataatatatgcaggggc |
24581484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 34034349 - 34034467
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | | ||| || ||||||||| ||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
34034349 |
cgtgagcatagctcagttggcagggacaatacattattatatgcagga-ccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
34034446 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| |||||| ||||| |||| |
|
|
| T |
34034447 |
ctagccactagactacctgac |
34034467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 40688709 - 40688625
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||||| |||| || |||||||||| |||||||||||||| |||| ||||| ||||||| | |||| ||||| |
|
|
| T |
40688709 |
ctcgtgatcttagctcagttggtagagatattgcattttatatgcaggggccagggttcgaaccccggacactctacttctccac |
40688625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 43870988 - 43871059
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
|||||||||| |||| |||| ||| | |||||||||||||||| ||| |||||| ||||||||||| |||||| |
|
|
| T |
43870988 |
tatatgcaggagccggggttcgaatcccggacaccccacttattcactttaaaa-gtgaatttctagccacta |
43871059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 15939294 - 15939373
Alignment:
| Q |
361 |
gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| |||||||||||| || |||||||||||||||||| || |||| ||||| || ||||||||||| ||||| |
|
|
| T |
15939294 |
gagcttaactcaattggcagagacattgcataatatatgcagaggttagggttcgaaccccgaacaccccacttctccac |
15939373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 17777223 - 17777149
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| | ||||||| ||||||| ||| |||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
17777223 |
ttagcttagttggcag-gatattgtatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac |
17777149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 436
Target Start/End: Original strand, 20435779 - 20435858
Alignment:
| Q |
358 |
cgtgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| |||| | | ||||||||||| | |||||| || ||| |||| |||||||||||| ||||||||| |
|
|
| T |
20435779 |
cgtgagcttagctcacttggtaagggatattgcatattttatgcaaggcccggggttcgaacctcggacatcccacttat |
20435858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23984292 - 23984209
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || || | ||||| |||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
23984292 |
cgtgagcttagctcaattggtagggacaaatgcattttatatgcaggggccagggttcgaaccccggacaccccacttctccac |
23984209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 383 - 434
Target Start/End: Complemental strand, 37512419 - 37512368
Alignment:
| Q |
383 |
atattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||||| |||| || ||||| |||| |||||||||||||||||||| |
|
|
| T |
37512419 |
atattgcataatttatgtagaggccggggttcgaacctcggacaccccactt |
37512368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 440
Target Start/End: Original strand, 40864400 - 40864483
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||| ||||||||||||||| |||| |||| ||||||| ||| || ||||| |
|
|
| T |
40864400 |
tcgtgagcttagctcagttggtaggaatattgcattttatatgcaggggccggggttcgaacaccggacactccaattctccac |
40864483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 44558031 - 44558086
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||||| | |||| ||||| |||||||||||||| ||||| |
|
|
| T |
44558031 |
attgcataatttatgcaggggctggggttcgaaccccggacaccccacttctccac |
44558086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 365 - 439
Target Start/End: Original strand, 1500970 - 1501044
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctcca |
1501044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 2145803 - 2145721
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||| ||| |||| || || |||||||||| ||||||||||| | |||||||| | | |||||||||||| ||||| |
|
|
| T |
2145803 |
cgtgaacttagttcagttggtagggacattgcataatttatgcaggggcagaggtttgaatccctgacaccccacttctccac |
2145721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3301813 - 3301895
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||| |||||| || |||| ||||| || |||| |||||| ||||| |
|
|
| T |
3301813 |
cgtgagcttagctcatttggtagggatattgcattttatatacaggggtcggggttcgaaccccgaacactccacttctccac |
3301895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9330569 - 9330487
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| ||| || ||||||||||| ||||||||||||| | ||| |||| ||||||| |||||||||||| |
|
|
| T |
9330569 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggggctgaggtgcgaactccggacactccacttatccac |
9330487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 11950064 - 11949982
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || || ||| || ||| |||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
11950064 |
cgtgagcttagctaagttggtagagaaattacacaatttatgcaggggacgaggttcgaaccccggacaccccacttctccac |
11949982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17487706 - 17487788
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || ||||||||||| ||||||||| ||| | |||| ||||| ||||||| ||||| ||||| |
|
|
| T |
17487706 |
cgtgaacttagctcagttggtagggatattgcatattatatgcagtggctggggttcgaaccccggacacttcacttctccac |
17487788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 18255656 - 18255698
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
18255656 |
tatatgcaggggccgagtttcgaacctcggacaccccacttat |
18255698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19684075 - 19684156
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
19684075 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacc-ccgacactccacttctccac |
19684156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 27497596 - 27497514
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || |||||||||| |||||||| |||| | ||||||||||| ||||||||||| ||||| |
|
|
| T |
27497596 |
cgtgagcatagctcagttggtagggatattgcatgttatatgcaagggctggagtttgaacctcaaacaccccacttctccac |
27497514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33262444 - 33262526
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| ||| || ||||| |||| |||||||||||| || |||| ||||||||||||| |||||| ||||| |
|
|
| T |
33262444 |
cgtgagtttagctcagctggtagggatatcgcattttatatgcaggggtcggggttcgaacctcggacactccacttctccac |
33262526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 34355727 - 34355805
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||| |||||| |||| || ||||||| ||| ||||||||||||||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
34355727 |
agctcagctcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccagacactccacttctccac |
34355805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39408758 - 39408676
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||| | |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
39408758 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccagacactccacttctccac |
39408676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 44822425 - 44822507
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| |||||||||| |||| |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
44822425 |
cgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccac |
44822507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 9796932 - 9796993
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||||| || |||| || ||||||| |
|
|
| T |
9796932 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcatcttataaggtgaatt |
9796993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 436
Target Start/End: Original strand, 10058871 - 10058948
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||| ||||||||| || || | ||||||||||||||| || || |||||||||| |||||| | ||||||| |
|
|
| T |
10058871 |
gtgagcttaactcaattggtagagacaatgcataatatatgcaaaggtcggggtttgaaccccggacaactcacttat |
10058948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 10262774 - 10262835
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| | |||||||||||||| ||||||| || ||||||| |
|
|
| T |
10262774 |
tatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataaagtgaatt |
10262835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 423 - 476
Target Start/End: Complemental strand, 12846828 - 12846775
Alignment:
| Q |
423 |
gacaccccacttatccaccttaaaatgtgaatttctatccactatactacttga |
476 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||||||||| |||||| |||| |||| |
|
|
| T |
12846828 |
gacaccccatttagccaccttaaaaagtgaatttctagccactagactatttga |
12846775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 15485664 - 15485733
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| ||||||| || || | ||||||||||| |||||| |
|
|
| T |
15485664 |
cgtgagcttagctcagttggtaaggatattgcatattatatgctggagcaggggtttgaaccttggacac |
15485733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 15625385 - 15625261
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgca--ggggccgtggtttgaacctcggacaccccacttatccaccttaaaa-tgtgaat |
454 |
Q |
| |
|
|||||| |||||||||||| || || |||||||||||||| | ||||||| |||| |||| | |||| |||||||| ||||||||| ||||||| |
|
|
| T |
15625385 |
cgtgagtttagctcaattgatagggacattgcataatatatatataggggccggggttcgaactccatacactccacttattcaccttaaatgtgtgaat |
15625286 |
T |
 |
| Q |
455 |
ttctatccactatactacttgacca |
479 |
Q |
| |
|
||||| |||||| ||||||||||| |
|
|
| T |
15625285 |
ttctagccactaggctacttgacca |
15625261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 17239936 - 17239997
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || | || |||||||||||||||||||||| || |||| || ||||||| |
|
|
| T |
17239936 |
tatatgcaggggtcgggattcgaacctcggacaccccacttattcatcttataaggtgaatt |
17239997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 18694787 - 18694832
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcagg |
403 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |
|
|
| T |
18694787 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
18694832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 23919544 - 23919463
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || || ||||||||||||||| ||||| || |||| ||| | | ||||||||| || ||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatggaggggtcggggttcgaatcccagacaccccatttctccac |
23919463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 451
Target Start/End: Original strand, 26336706 - 26336775
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||| |||||| ||||| || |||| |||||||| |||| |||||| | ||| |||||||||| |
|
|
| T |
26336706 |
gatattgcatattatatgaaggggtcggggttcgaacctcgaacactccacttcttcacattaaaatgtg |
26336775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 27297177 - 27297258
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| | |||||||| || | | || ||||| ||||||| |||||| |||| |
|
|
| T |
27297177 |
cgtgagcttagctcagttggtagggatattgcatattgtatgcaggagctgggattcgaaccccggacactccacttctcca |
27297258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 28153209 - 28153128
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| |||| |||| || |||||||||| |||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
28153209 |
gtgagcttaactcagttggtagggatattgcatgttatatgcaggattcggggttcgaaccccggacaccccacttctccac |
28153128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 33001613 - 33001552
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||| |||||| |||||||| | |||||||||||||||| || |||| || ||||||| |
|
|
| T |
33001613 |
tatatgcaagggccggggtttgaatcccggacaccccacttattcatcttataaggtgaatt |
33001552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 36386173 - 36386121
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
36386173 |
tatatgcaggggtcg-ggtttgaatctcggacaccccacttattcactttaaaa |
36386121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 37352560 - 37352479
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||| |||| |||| || ||||||||||| ||||||||||||||| |||||||| || |||||||| || ||||| |
|
|
| T |
37352560 |
gtgagtttaactcagttggtagggatattgcatattatatgcaggggccgaagtttgaactccgaacaccccatttctccac |
37352479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 8e-20; HSPs: 158)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 21265658 - 21265740
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
21265658 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
21265740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33207207 - 33207289
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
33207207 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac |
33207289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 22563388 - 22563470
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
22563388 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccac |
22563470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36666644 - 36666562
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
36666644 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac |
36666562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42490478 - 42490396
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
42490478 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac |
42490396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 47469141 - 47469059
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||| ||||||||||| | |||| ||||| |||||||||||||| ||||| |
|
|
| T |
47469141 |
cgtgagcttagctcagttggcagggacattgcataatttatgcaggggctgaggttcgaaccccggacaccccacttctccac |
47469059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 362 - 479
Target Start/End: Complemental strand, 4069702 - 4069586
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatc |
461 |
Q |
| |
|
||||||||||| |||| | |||||||||| |||||||||||||||| |||||||||| |||| | |||||||| |||||||| | ||||| ||||| | |
|
|
| T |
4069702 |
agcttagctcagttggtacagatattgcattatatatgcaggggccggggtttgaaccccggattctccacttattcaccttaagaggtgaa-ttctacc |
4069604 |
T |
 |
| Q |
462 |
cactatactacttgacca |
479 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
4069603 |
cactaggctacttgacca |
4069586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 24874973 - 24875054
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||| |||||| |||| | |||| |||||||||||||||||||| |||| |
|
|
| T |
24874973 |
cgtgagcttagctcagttggtagggatattgcataatttatgcatgggcaggggttcgaacctcggacaccccacttctcca |
24875054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 5190847 - 5190767
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||| |||||||||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
5190847 |
tgagcttagctcaattggtagggatatcgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctccac |
5190767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 359 - 466
Target Start/End: Complemental strand, 13870177 - 13870070
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc |
457 |
Q |
| |
|
|||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||||||| | |||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
13870177 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttattcactttaaaa-gtgaatttc |
13870079 |
T |
 |
| Q |
458 |
tatccacta |
466 |
Q |
| |
|
|| |||||| |
|
|
| T |
13870078 |
tagccacta |
13870070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 356 - 451
Target Start/End: Complemental strand, 27178778 - 27178683
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||| ||| ||||||||||||||| || ||| |||||||||||||||| ||||| |||||||||| |
|
|
| T |
27178778 |
ctcgtgagcttaactcaattggtaaggatattgtatattatatgcaggggccggaattcgaatctcggacaccccacttctccacattaaaatgtg |
27178683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 1570260 - 1570178
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
1570260 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
1570178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6438132 - 6438050
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6438132 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
6438050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6893305 - 6893223
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6893305 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttttccac |
6893223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7166295 - 7166213
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
7166295 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccac |
7166213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 15819669 - 15819587
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
15819669 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
15819587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 16343030 - 16343112
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
16343030 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
16343112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 366 - 479
Target Start/End: Original strand, 17350067 - 17350180
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac |
464 |
Q |
| |
|
||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||||| |||| |
|
|
| T |
17350067 |
tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttctagccac |
17350165 |
T |
 |
| Q |
465 |
tatactacttgacca |
479 |
Q |
| |
|
|| ||| ||||||| |
|
|
| T |
17350166 |
taggctatttgacca |
17350180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 18551701 - 18551619
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| ||||||||||||||| |||||||||| || |||| |||||| ||||| |
|
|
| T |
18551701 |
cgtgagcttagctcagttggtatggatattgcatattatatgcaggggccggggtttgaaccccgaacactccacttctccac |
18551619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 387 - 477
Target Start/End: Original strand, 32635168 - 32635258
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac |
477 |
Q |
| |
|
||||| ||||||||||||| | |||| ||||| |||||||||||||||| |||||||| | ||||||||||| |||||| ||||||||| |
|
|
| T |
32635168 |
tgcattatatatgcaggggttggggttcgaaccccggacaccccacttattcaccttaagaggtgaatttctagccactaggctacttgac |
32635258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34058216 - 34058298
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
34058216 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacactccacttctccac |
34058298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 356 - 434
Target Start/End: Complemental strand, 37662627 - 37662549
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||| |||||||||||| || ||| ||||| |||||||||||||| |
|
|
| T |
37662627 |
ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggtacgaaccccggacaccccactt |
37662549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 459
Target Start/End: Original strand, 39238714 - 39238815
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
39238714 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
39238812 |
T |
 |
| Q |
457 |
cta |
459 |
Q |
| |
|
||| |
|
|
| T |
39238813 |
cta |
39238815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 40678821 - 40678942
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| || || |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
40678821 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattcactttaaaa-gtgaattt |
40678919 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
40678920 |
ctagccactaggctacctgacca |
40678942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42550077 - 42549995
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||||| || || ||||||||||| || |||||||||||| ||||| |||||| ||| |||||||| ||||| |
|
|
| T |
42550077 |
cgtgagcttagctcaatcggtagggatattgcatattacatgcaggggccgaggttttaacctcagacgccccacttctccac |
42549995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 44732635 - 44732717
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||| |||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
44732635 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccac |
44732717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 47763482 - 47763361
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| ||| |||||||||||| ||||||||| ||| |||||| |||||||| |
|
|
| T |
47763482 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttattcactttaaaa-gtgaattt |
47763384 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| |||| |||||| |
|
|
| T |
47763383 |
ctagccactaggctacctgacca |
47763361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 50899578 - 50899496
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
50899578 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
50899496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 46965742 - 46965823
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
46965742 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcca |
46965823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 382 - 446
Target Start/End: Complemental strand, 42946539 - 42946475
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa |
446 |
Q |
| |
|
|||| |||||| ||||||||||||| | |||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
42946539 |
gataatgcatattatatgcaggggctggggtttgaaccccggacaccccacttattcaccttaaa |
42946475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 52426981 - 52426859
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa--atgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| |||||||||||||||||||| |||| | ||||||||| || ||||| || || ||||| | | |
|
|
| T |
52426981 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgtggttcgaactccagacaccccatttctccacatttaatgatgtg-agt |
52426883 |
T |
 |
| Q |
456 |
tctatccactatactacttgacca |
479 |
Q |
| |
|
|||| |||||| |||||||||||| |
|
|
| T |
52426882 |
tctagccactagactacttgacca |
52426859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 353 - 479
Target Start/End: Original strand, 21884569 - 21884694
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||| ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| ||||||| || ||| |
|
|
| T |
21884569 |
agtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtg |
21884667 |
T |
 |
| Q |
452 |
aatttctatccactatactacttgacca |
479 |
Q |
| |
|
|| ||||| |||||| ||||| |||||| |
|
|
| T |
21884668 |
aa-ttctaaccactagactacatgacca |
21884694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 29491468 - 29491588
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
29491468 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaa--gtgaattt |
29491565 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| ||| ||||||| |
|
|
| T |
29491566 |
ctagccactaggctatttgacca |
29491588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 387 - 486
Target Start/End: Original strand, 32660858 - 32660957
Alignment:
| Q |
387 |
tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgaccacagaaaa |
486 |
Q |
| |
|
||||| |||||||||||||| | |||| |||| |||||||||||||| | |||||||| | ||||||||||| |||||| ||||||||| ||| |||| |
|
|
| T |
32660858 |
tgcattatatatgcaggggctggggttcaaaccccggacaccccactttttcaccttaagaggtgaatttctagccactaggctacttgacaacaaaaaa |
32660957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2277756 - 2277838
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| ||||| |
|
|
| T |
2277756 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggagactccacttctccac |
2277838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2754362 - 2754444
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || ||||||||||| ||||||| ||||||| |||| ||||| ||||||||| |||| ||||| |
|
|
| T |
2754362 |
cgtgagcttagcttagttggtagggatattgcatattatatgccggggccggggttcgaaccccggacaccctacttctccac |
2754444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7180682 - 7180600
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || |||||||||| ||||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
7180682 |
cgtgaggttagctcagttggtaggaatattgcatattatatgcaggggccggagttcgaaccccggacaccccacttctccac |
7180600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 8780794 - 8780852
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||||||||||| ||||| |
|
|
| T |
8780794 |
gatattgcatattatatgcaggggccgaggttcaaacctcggacaccccacttctccac |
8780852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 8984573 - 8984492
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
8984573 |
cgtgagcttaactcagttggcagggatattgcatattatatgcaggagccggggttcgaacc-cggacactccacttctccac |
8984492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11215003 - 11215085
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
11215003 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacactccacttctccac |
11215085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11333666 - 11333748
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || || |||||||||| ||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
11333666 |
cgtgaacttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccac |
11333748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11491687 - 11491769
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| |||| || || |||||||||| ||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
11491687 |
cgtgaacttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccac |
11491769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 359 - 479
Target Start/End: Complemental strand, 13538513 - 13538391
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac-cttaaaatgtg-aattt |
456 |
Q |
| |
|
|||| ||||| ||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||| || || |||| | || |
|
|
| T |
13538513 |
gtgaacttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagtt |
13538414 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
13538413 |
ctagccactatactacttgacca |
13538391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19011357 - 19011439
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||||| | |||| ||||| | || || |||||| ||||| |
|
|
| T |
19011357 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccac |
19011439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19564220 - 19564139
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||||| || |||||||||| ||||||||| ||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
19564220 |
cgtgagtttagctcagttggcaaggacattgcataatttatgcaggg-ccggggttcgaacctcggacaccccacttctccac |
19564139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 25819183 - 25819304
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || ||||| ||| |||| |||| ||||| |||| ||||||||||| ||| |||||| |||||||| |
|
|
| T |
25819183 |
cgtgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttattcactttaaaa-gtgaattt |
25819281 |
T |
 |
| Q |
457 |
ctatccactatactacttgacca |
479 |
Q |
| |
|
||| |||||| ||||| |||||| |
|
|
| T |
25819282 |
ctagccactagactacctgacca |
25819304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 25999852 - 25999934
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
25999852 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac |
25999934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32594253 - 32594335
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
32594253 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac |
32594335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33254730 - 33254812
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
33254730 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccac |
33254812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33274902 - 33274984
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
33274902 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccac |
33274984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45333779 - 45333698
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
45333779 |
cgtgagcttagctcagttggcagggatattgcat-atatatgcaggggctggggttcgaaccccagacactccacttctccac |
45333698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 48638534 - 48638616
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
48638534 |
cgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccac |
48638616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 4354165 - 4354104
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
4354165 |
tatatgcaggggccggggttcgaacttcggacaccccacttattcaccttataaagtgaatt |
4354104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 23991331 - 23991250
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| ||||||| || |||||||||| ||||||||||||| |||| ||||| ||||||||||||| ||||| |
|
|
| T |
23991331 |
gtgagcttgactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccctggacaccccacttctccac |
23991250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 39433393 - 39433454
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
39433393 |
tatatgcaggggccgatgttcgaacctcggacaccccacttattcaccttataaggtgaatt |
39433454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 393 - 478
Target Start/End: Complemental strand, 50859428 - 50859344
Alignment:
| Q |
393 |
atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacc |
478 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||| ||| |||||||||| ||||| ||||| |||||| |||||||||| |
|
|
| T |
50859428 |
atatatgcaggggccggggttcaaaccccggacaccccacatattcaccttaaaaggtgaa-ttctagccactaggctacttgacc |
50859344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 437
Target Start/End: Complemental strand, 2052779 - 2052699
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatc |
437 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
2052779 |
cgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttatc |
2052699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 6463102 - 6463022
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||| || ||||||| || ||||||||||||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
6463102 |
tgagcttagctcagttggtagggatattgtattttatatgcaggggccggggttcgaaccccggacactccacttctccac |
6463022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 390 - 446
Target Start/End: Complemental strand, 10052507 - 10052451
Alignment:
| Q |
390 |
ataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa |
446 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||||| ||||| ||||| |
|
|
| T |
10052507 |
ataatatatgcaggggccgaggttcgaaccccggacaccccacttctccacattaaa |
10052451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 364 - 440
Target Start/End: Complemental strand, 19063395 - 19063319
Alignment:
| Q |
364 |
cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| || | || ||||||||||| ||||||||||||||| |||| | ||| |||||||||||||| ||||| |
|
|
| T |
19063395 |
cttagctcagttagtagagatattgcatattatatgcaggggccggggttcgtaccccggacaccccacttctccac |
19063319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Complemental strand, 19976612 - 19976541
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| ||| ||| |||||| ||||||||||| |||||| |
|
|
| T |
19976612 |
tatatgcaggggccggggttcgaaccccggacaccccacatattcactttaaaa-gtgaatttctagccacta |
19976541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 31124704 - 31124624
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| |||||| || |||||||||| ||||||||||||| |||| |||| |||| ||||||||| ||||| |
|
|
| T |
31124704 |
tgagcttagctcagttggcaaggacattgcataatttatgcaggggccggggttcgaactccggataccccacttctccac |
31124624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 359 - 439
Target Start/End: Complemental strand, 34562854 - 34562774
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||||||| |||| |||| || |||||| |||||| ||| ||||||||| |||| ||||| |||||||||||||| |||| |
|
|
| T |
34562854 |
gtgagcttaactcagttggtagggatattacataatttatacaggggccgaggttcgaaccccggacaccccacttctcca |
34562774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 366 - 434
Target Start/End: Complemental strand, 47930731 - 47930663
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||| |||| || ||||||||||| ||||||||||||| | |||| |||||||||| ||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcggataccccactt |
47930663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 451
Target Start/End: Original strand, 10632703 - 10632790
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggaca-ccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||||||||||| | || |||||||||| |||||||||| || |||| ||||| |||||| |||||||| ||||| || ||||||| |
|
|
| T |
10632703 |
ttagctcaattggcggagacattgcataatttatgcaggggtcggggttcgaaccccggacacccccacttctccacatttaaatgtg |
10632790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40519612 - 40519529
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggcc-gtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| ||| | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
40519612 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggggttcgaaccccggacactccacttctccac |
40519529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4482666 - 4482584
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| ||| ||||| |||| || |||||| ||||| |
|
|
| T |
4482666 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccac |
4482584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4553614 - 4553532
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || |||||||||| ||||||||||||| | |||| ||| |||||||||| ||||| ||||| |
|
|
| T |
4553614 |
cgtgagcttaactcagttggtagaaatattgcatattatatgcaggggctgaggttcgaatctcggacacctcacttctccac |
4553532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7191034 - 7191116
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||| ||||||||| ||| || ||||||||||| ||||||||||||| | |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
7191034 |
cgtgaccttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaaccccggacacctcacttctccac |
7191116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 353 - 443
Target Start/End: Complemental strand, 7573768 - 7573678
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||||| |||||||| |||||||| ||| |||||||||||||||||||||| | || | ||| | |||||||||||||||||| |||| |
|
|
| T |
7573768 |
agtctcatgagcttaactcaattgacaggaatattgcataatatatgcagggatcagggatcgaatcccggacaccccacttatcctcctt |
7573678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8865856 - 8865938
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || | || ||||| |||||| |||||| ||||| |
|
|
| T |
8865856 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaaccctggacactccacttctccac |
8865938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9866252 - 9866170
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||| | || |||| |||||| ||||| |
|
|
| T |
9866252 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccgaacactccacttttccac |
9866170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11860044 - 11860126
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||| ||| ||||| || |||| ||||| |||||||||||||| ||||| |
|
|
| T |
11860044 |
cgtgagcttagctcagttggcagaaacattgcataatttatataggggtcggggttcgaaccccggacaccccacttctccac |
11860126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 13773170 - 13773252
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
13773170 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac |
13773252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 16526245 - 16526163
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||| ||| ||| ||||| || |||| |||||| ||||| |
|
|
| T |
16526245 |
cgtgagcttagctcaattggtagggatattgcatattatatgcaggagcctgtgttcgaaccccgtacactccacttctccac |
16526163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 16997327 - 16997245
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || | |||||| | ||||||||||||| |||| ||||| |||||||| ||||| ||||| |
|
|
| T |
16997327 |
cgtgagcttagctcagttggtagagacaatgcatattttatgcaggggccgaggttcgaaccccggacacctcacttctccac |
16997245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 18467266 - 18467184
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
18467266 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac |
18467184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 18534003 - 18534085
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| ||| | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
18534003 |
cgtgagcttagctcagttggtagagatattgcatattatatgtaggagtcggggttcgaaccccggacactccacttctccac |
18534085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 356 - 434
Target Start/End: Complemental strand, 18607879 - 18607801
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| | |||| || || |||||||||| ||||||||||| | |||| ||||| || ||||||||||| |
|
|
| T |
18607879 |
ctcgtgagcttagctgagttggtagggacattgcataatttatgcaggggctggggttcgaaccccgaacaccccactt |
18607801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 35605691 - 35605609
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| ||||||||||| ||||| |
|
|
| T |
35605691 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctaaacaccccacttctccac |
35605609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42054335 - 42054417
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| ||||| |||||| ||||| |
|
|
| T |
42054335 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccctggacattccacttctccac |
42054417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43021690 - 43021608
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||| | |||| || || | |||||| | |||||||||| || |||| |||||||||||||||||||| ||||| |
|
|
| T |
43021690 |
cgtgagcttagcttagttggtagggacaatgcatattttatgcaggggtcggggttcgaacctcggacaccccacttctccac |
43021608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43884796 - 43884878
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
43884796 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccac |
43884878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 3269621 - 3269682
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| |
|
|
| T |
3269621 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc |
3269682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 11405491 - 11405552
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
11405491 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
11405552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 382 - 443
Target Start/End: Original strand, 19424069 - 19424130
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
19424069 |
gataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
19424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 21401476 - 21401419
Alignment:
| Q |
383 |
atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| |||||||| ||||| ||||| ||||| |
|
|
| T |
21401476 |
atattgcatattatatgcaggggccgcggttcgaacctcgaacaccacacttctccac |
21401419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 24134719 - 24134642
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
24134719 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
24134642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 26550496 - 26550565
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac |
427 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |
|
|
| T |
26550496 |
cgtgagcttaactcagttggtagggatattgcatactatatgcaggagccggggttcgaaccccggacac |
26550565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 370 - 451
Target Start/End: Complemental strand, 26909926 - 26909845
Alignment:
| Q |
370 |
tcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||| || |||||||||| ||||||| ||| | |||| ||||| ||||||||||||| ||||| || ||||||| |
|
|
| T |
26909926 |
tcaattggcagggacattgcataatttatgcagaggcgggggttcgaaccctggacaccccacttctccacatttaaatgtg |
26909845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 30734493 - 30734436
Alignment:
| Q |
383 |
atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||||| |||||| ||||| |
|
|
| T |
30734493 |
atattgcatattatatgcaggggtccgggtttgaacctcggacactccacttctccac |
30734436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 386 - 451
Target Start/End: Original strand, 35068717 - 35068782
Alignment:
| Q |
386 |
ttgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||| |||||| |||||||| |||| ||||| |||||||||||||| ||||| ||| |||||| |
|
|
| T |
35068717 |
ttgcatattatatggaggggccggggttcgaaccccggacaccccacttctccacattagaatgtg |
35068782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 451
Target Start/End: Complemental strand, 36314039 - 36313954
Alignment:
| Q |
366 |
tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||| |||| || ||||||||||| ||| ||||||||||| ||| ||||| || ||||||||||| ||||| ||| |||||| |
|
|
| T |
36314039 |
tagctcagttggtagggatattgcatattatttgcaggggccggagttcgaaccccgaacaccccacttctccacattataatgtg |
36313954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 49251455 - 49251394
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || |||| ||||| | |||||||||||||| ||||||| |||||||||| |
|
|
| T |
49251455 |
tatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataatgtgaatt |
49251394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 50199536 - 50199487
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
50199536 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
50199487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 1151761 - 1151837
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||| |||| |||| | || ||||| ||||||| |||||| |
|
|
| T |
1151761 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggagccgggattcgaaccccggacactccactt |
1151837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 6702578 - 6702654
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| | ||||| |||||| |
|
|
| T |
6702578 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccactt |
6702654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 9527424 - 9527543
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| | ||||||||||| || |||||||||| ||||||||||||||| || |||| || ||||| || |
|
|
| T |
9527424 |
cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattcatcttataaggtgaa-tt |
9527522 |
T |
 |
| Q |
457 |
ctatccactatactacttgac |
477 |
Q |
| |
|
||| |||||| ||||| |||| |
|
|
| T |
9527523 |
ctagccactagactacctgac |
9527543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 10851824 - 10851908
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||| |||||||||||| || |||| ||||| | || || |||||| ||||| |
|
|
| T |
10851824 |
ctcgtgagcttagctcaattggtaaggatattgtatattatatgcaggggacggggttcgaaccccagaaactccacttctccac |
10851908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 12374581 - 12374506
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||| |||| || |||||||| ||||||||||| |||||||| ||| || |||| ||||| |||||||||||||| |
|
|
| T |
12374581 |
cgtgagtttagttcgattggcagagatattgcatattatatgcaagggtcggggttcgaacc-cggacaccccactt |
12374506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 26584814 - 26584738
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| |
|
|
| T |
26584814 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
26584738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 34750457 - 34750382
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||| || ||||||||| || ||||||||||||| |||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
34750457 |
cgtgagcataactcaattggtagggatattgcataatttatgca-gggccgatgtttgaaccctggacaccccactt |
34750382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 394 - 487
Target Start/End: Original strand, 43020646 - 43020740
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaatttctatccactatactacttgaccacagaaaag |
487 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||||||||| || |||||| |||||||||| ||||| |||||| ||||||||| ||| ||||| |
|
|
| T |
43020646 |
tatatgcaggggttggggttcgaacctcggacaccccactcattcaccttgaaaaatgtgaa-ttctagccactacgctacttgacaacaaaaaag |
43020740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 431
Target Start/End: Complemental strand, 49503217 - 49503145
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca |
431 |
Q |
| |
|
|||||| ||||||||||||||| || ||| |||||| ||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
49503217 |
gtgagcatagctcaattggcagggacattacataatttatgcaggggccggagttcgaacgccggacacccca |
49503145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 6213424 - 6213499
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||| ||||| |||||| | |||||||| | |||| ||||||||| |
|
|
| T |
6213424 |
gtgaacttagctcaattggtagggatattgcatattatatacaggggtcagggtttgaatcccggataccccactt |
6213499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 6712178 - 6712095
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||| ||||||||||||||| |||| |||| ||||||| | |||| ||||| |
|
|
| T |
6712178 |
tcgtgagcttagctcagttggtaggtatattgcattttatatgcaggggccggggttcaaaccccggacactctacttctccac |
6712095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 456
Target Start/End: Original strand, 38021250 - 38021348
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| |||||| || | ||||| || |||||||||||||| ||| ||||| |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
38021250 |
cgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcactttaaaa-gtgaattt |
38021348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 45416219 - 45416164
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||| | |||||||||||||| ||||| |
|
|
| T |
45416219 |
attgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccac |
45416164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Original strand, 50536973 - 50537048
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||| || ||||||||||| ||||||||| | | |||| |||||||||||||||||||| ||||| |
|
|
| T |
50536973 |
ttagcttaattggtagggatattgcatataatatgcaggagttggggttcgaacctcggacaccccacttctccac |
50537048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 403
Target Start/End: Original strand, 51933510 - 51933553
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcagg |
403 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgcagg |
51933553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 353 - 459
Target Start/End: Complemental strand, 52833208 - 52833102
Alignment:
| Q |
353 |
agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||| ||||||| || |||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||| |||| |||| ||| |||||| ||| |
|
|
| T |
52833208 |
agtcccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttattcactttaaaa-gtg |
52833110 |
T |
 |
| Q |
452 |
aatttcta |
459 |
Q |
| |
|
|||||||| |
|
|
| T |
52833109 |
aatttcta |
52833102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 2352633 - 2352551
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||| |||||||||| |||| |||| ||| | || |||| |||||| ||||| |
|
|
| T |
2352633 |
cgtgagcttagctcagttgatagagatattgcatattatatgcaggagccggggttcgaatcccgaacactccacttctccac |
2352551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 354 - 432
Target Start/End: Complemental strand, 2997729 - 2997651
Alignment:
| Q |
354 |
gtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||||||||||| ||||| || | || || |||||||||| ||||||||||| | |||| ||||| | |||||||||| |
|
|
| T |
2997729 |
gtctcgtgagctttgctcagttagtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccac |
2997651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6130101 - 6130019
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| | || |||| |||| ||||||| |||||| ||||| |
|
|
| T |
6130101 |
cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaactccggacactccacttctccac |
6130019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8741475 - 8741557
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || || ||| |||||| ||||||||||| | |||| ||||| | |||||||||||| ||||| |
|
|
| T |
8741475 |
cgtgagcttagttcagttggtagggacattacataatttatgcaggggcaggggttcgaacccctgacaccccacttctccac |
8741557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10664862 - 10664781
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||| | | || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10664862 |
cgtgagcttagctcagttggtagggatattgcatattatatgca-gagtcggggttcgaaccccggacactccacttctccac |
10664781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 12404358 - 12404439
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||| |||||||| || ||||||||||| |||||||| |||| | |||| ||||| || ||||||||||| ||||| |
|
|
| T |
12404358 |
cgtgagattagatcaattggtagggatattgcatattatatgca-gggctggggttcgaaccccgaacaccccacttctccac |
12404439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 15368840 - 15368882
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
15368840 |
tatatgcaggggccggggttcgaaccccggacaccccacttat |
15368882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 15775741 - 15775791
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg |
408 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||| |||||||||| |||| |
|
|
| T |
15775741 |
cgtgagcttaactcaattggtagggatattgcatattatatgcaggagccg |
15775791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17671478 - 17671396
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||| |||| |||||||||||||| ||| ||||| ||||||| |||||| ||||| |
|
|
| T |
17671478 |
cgtgagcttagctcagttggtagggatatcgcatttcatatgcaggggccggagttcgaaccccggacactccacttctccac |
17671396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 18512607 - 18512561
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
18512607 |
tatatgcaggggccggggttcgaaccccggacaccccacttctccac |
18512561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 360 - 434
Target Start/End: Complemental strand, 19246722 - 19246649
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||| ||||||| | || |||||||||| ||||||| ||||| |||| |||| |||||||||||||| |
|
|
| T |
19246722 |
tgagcttagcttaattggctgagacattgcataatttatgcagaggccg-ggttccaaccgcggacaccccactt |
19246649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 439
Target Start/End: Complemental strand, 19276017 - 19275935
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||| |||||||||||||||| || ||||||||||||| |||| | ||| || ||| ||||||| |||||| ||||| |||| |
|
|
| T |
19276017 |
tcgtcagcttagctcaattggtagggatattgcataatttatgtatgggtcgaagttcgaacctcagacacctcacttttcca |
19275935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 23233969 - 23234035
Alignment:
| Q |
374 |
ttggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| || |||| ||||| | ||||||| |||| ||||| |
|
|
| T |
23233969 |
ttggcagggatattgcatattatatgcaggggtcggggttcgaaccccagacaccctacttctccac |
23234035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25036330 - 25036248
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| ||||||| | |||||||||| ||||||||||||| | || ||||| || |||||||| || ||||| |
|
|
| T |
25036330 |
cgtgagtttagctcagttggcaggaacattgcataatttatgcaggggccgggattcgaaccccgaacaccccatttctccac |
25036248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25041542 - 25041460
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| ||||||| | |||||||||| ||||||||||||| | || ||||| || |||||||| || ||||| |
|
|
| T |
25041542 |
cgtgagtttagctcagttggcaggaacattgcataatttatgcaggggccgggattcgaaccccgaacaccccatttctccac |
25041460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 360 - 418
Target Start/End: Original strand, 27818573 - 27818631
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaac |
418 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| ||||| || |||||| ||||||||| |
|
|
| T |
27818573 |
tgagcttagctcagttggtagggatattgcatattatattcatgggccggggtttgaac |
27818631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 28564389 - 28564331
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||| | |||||||||||| | |||| |||||||||||||||||||| ||||| |
|
|
| T |
28564389 |
gatattgcagattatatgcaggggttggggttcgaacctcggacaccccacttctccac |
28564331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 397 - 443
Target Start/End: Original strand, 29332322 - 29332368
Alignment:
| Q |
397 |
atgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||| |||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
29332322 |
atgcatgggccggggtttgaaccccggacaccccacttattcacctt |
29332368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 31401313 - 31401239
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac |
432 |
Q |
| |
|
||||||||||||||| ||| || || |||||||||| |||||||| |||| |||| |||| |||||||||||| |
|
|
| T |
31401313 |
cgtgagcttagctcagttgatagggacattgcataatttatgcaggagccgaggttcaaaccccggacaccccac |
31401239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 433
Target Start/End: Complemental strand, 31762063 - 31761989
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact |
433 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||| ||||| || |||| |||| ||||||| ||||| |
|
|
| T |
31762063 |
gtgagcttagctcagttggcagtgatattgcatattatatttaggggtcgaggttcgaacaccggacactccact |
31761989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34656463 - 34656381
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||| |||||||| ||| || |||||||||| |||||||||||| | |||| ||||||||||||| |||||| ||||| |
|
|
| T |
34656463 |
cgtgagtttagctcagttgatagagatattgcattttatatgcaggggttggggttcgaacctcggacactccacttctccac |
34656381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 429
Target Start/End: Complemental strand, 35121116 - 35121046
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc |
429 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||| || |||||||| | |||||||||| ||||||||| |
|
|
| T |
35121116 |
gtgagcttagcttagttggtagcgatattgcatattacatgcagggtttggggtttgaaccccggacaccc |
35121046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 36860624 - 36860682
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||||||| ||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
36860624 |
gatattgcatattatatgcagaggccggggtccgaaccccggacaccccacttctccac |
36860682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40375383 - 40375301
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||| |||| || ||||||||||| |||||||||| |||| ||| ||||| ||||||| | |||| ||||| |
|
|
| T |
40375383 |
cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggtacgaaccccggacactctacttctccac |
40375301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 41182809 - 41182851
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
|||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
41182809 |
tatatgcaggggtcggggtttgaaccccggacaccccacttat |
41182851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 42831946 - 42832043
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||| ||||||| |||| || || ||||||| || |||||||||||| | |||| |||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
42831946 |
cgtgagcatagctcagttggtag-gacattgcattattatatgcaggggctggggttcaaaccccggacaccccacttattcaccttataaggtgaatt |
42832043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45517336 - 45517254
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| |||| || |||||||||| ||||| ||||||||| | || ||||| ||||||| |||||| ||||| |
|
|
| T |
45517336 |
cgtgagcttagttcagttggtagggatattgcattttatatacaggggccgggattggaaccccggacactccacttctccac |
45517254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 419
Target Start/End: Original strand, 52369598 - 52369660
Alignment:
| Q |
357 |
tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |
|
|
| T |
52369598 |
tcgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc |
52369660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Original strand, 1721175 - 1721228
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||||||| | || ||||| |||||||| ||||||| |||||||||| |
|
|
| T |
1721175 |
tatatgcaggggccgggtttcgaaccccggacacctcacttattcaccttaaaa |
1721228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 362 - 419
Target Start/End: Original strand, 2556562 - 2556619
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| |
|
|
| T |
2556562 |
agcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc |
2556619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 2643875 - 2643822
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
|||||||| ||| || |||||||||| | |||||||||||||| |||||||||| |
|
|
| T |
2643875 |
tatatgcatgggtcggggtttgaaccccagacaccccacttattcaccttaaaa |
2643822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 410 - 447
Target Start/End: Complemental strand, 3046213 - 3046176
Alignment:
| Q |
410 |
ggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3046213 |
ggtttgaacctctgacaccccacttattcaccttaaaa |
3046176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 3341796 - 3341747
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| || | ||||| |||||||||||||||| |||||| |
|
|
| T |
3341796 |
tatatgcaggggccggggatcgaaccccggacaccccacttattcacctt |
3341747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 3694982 - 3694902
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||| ||| |||| |||| ||| | ||||||| |||||| ||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgtaggagccggggttcgaatc-cggacactccacttctccac |
3694902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 479
Target Start/End: Original strand, 9163315 - 9163403
Alignment:
| Q |
391 |
taatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttctatccactatactacttgacca |
479 |
Q |
| |
|
|||||||||||| || || |||||||||||||||| | ||||||| || ||| |||||||||| ||||| |||||| ||||| |||||| |
|
|
| T |
9163315 |
taatatatgcagaggtcgaagtttgaacctcggacatcacacttattcatcttaaaaatgtgaa-ttctagccactagactacctgacca |
9163403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 455
Target Start/End: Original strand, 9166562 - 9166627
Alignment:
| Q |
391 |
taatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatt |
455 |
Q |
| |
|
|||||||||||| || || |||||||||||||||||| |||| || |||||| |||||||||||| |
|
|
| T |
9166562 |
taatatatgcagaggtcggagtttgaacctcggacaccacactaattcaccttaaaaatgtgaatt |
9166627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 9768869 - 9768820
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
9768869 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
9768820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 15774372 - 15774311
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||| ||||| || |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
15774372 |
tatatgtaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
15774311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 19793561 - 19793622
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| || ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
19793561 |
tatatgcaggggccggaattcgaaccccggacaccccacttattcaccttataaggtgaatt |
19793622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 431
Target Start/End: Complemental strand, 23369098 - 23369049
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacacccca |
431 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
23369098 |
gatattgtatattatatgcaggggccgcggttcgaaccccggacacccca |
23369049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 23464046 - 23463985
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| | ||| ||| || ||||||| |
|
|
| T |
23464046 |
tatatgcaggggccggggttcgaaccccggacaccccacttgttcactttataaggtgaatt |
23463985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 27233990 - 27234071
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||||||| | |||||||||| ||||||||||||||| |||| ||| | || |||| |||||| ||||| |
|
|
| T |
27233990 |
gtgagcttagttcaattggtatgaatattgcatattatatgcaggggccggggttcgaatcccgaacactccacttctccac |
27234071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 410 - 455
Target Start/End: Complemental strand, 34560382 - 34560337
Alignment:
| Q |
410 |
ggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
34560382 |
ggttcgaacctcggacaccccacttattcaccttataaggtgaatt |
34560337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 34702408 - 34702331
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||| ||||||| |
|
|
| T |
34702408 |
tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacacctcacttat |
34702331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 37733790 - 37733851
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
||||||||| || || |||| ||||| |||||||||||||||| ||||||| || ||||||| |
|
|
| T |
37733790 |
tatatgcagtggacggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
37733851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 39434653 - 39434714
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt |
455 |
Q |
| |
|
|||||| ||| |||| ||| |||||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
39434653 |
tatatgtaggagccgatgttcgaacctcggacaccccacttattcaccttataaggtgaatt |
39434714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 48897185 - 48897104
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
|||||||||| |||| |||| || |||||||||| |||||||||||||| |||| |||| ||||||| |||||| |||| |
|
|
| T |
48897185 |
cgtgagcttaactcatttggtaggaatattgcatattatatgcaggggccagggttcgaacaccggacactccacttctcca |
48897104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 402 - 478
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||| ||||||||||||| || ||||||||||| ||||||||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
402 |
cgtgaacttagctcaattgatagggatattgcatattatatgcaggggccggggttcgaacctcggacactccactt |
478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 11994 - 12078
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||||||||| ||||||| |||||| ||||| |
|
|
| T |
11994 |
ctcgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggtttgaaccccggacactccacttctccac |
12078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 433
Target Start/End: Original strand, 46528 - 46603
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact |
433 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| ||||| |
|
|
| T |
46528 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccact |
46603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 368 - 451
Target Start/End: Original strand, 24392 - 24475
Alignment:
| Q |
368 |
gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| ||||||| |||||| | ||| || ||||||| |
|
|
| T |
24392 |
gctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtg |
24475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 928 - 846
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
928 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 59785 - 59867
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
59785 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
59867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 486
Target Start/End: Complemental strand, 4902 - 4775
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt |
456 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||| | |||| ||| | |||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
4902 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggcgg-ggttcgaatcccggacaccccacttattcactttaaaa-gtgaattt |
4805 |
T |
 |
| Q |
457 |
ctatccactatactacttgaccacagaaaa |
486 |
Q |
| |
|
||| |||||| ||||||||||||| |||| |
|
|
| T |
4804 |
ctagccactaggctacttgaccacaaaaaa |
4775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 56325 - 56386
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
56325 |
cgtgagcttaactcaattggcagggatattgcatattatatgcaggggccggggttcgaacc |
56386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 363 - 434
Target Start/End: Original strand, 1871 - 1942
Alignment:
| Q |
363 |
gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccactt |
1942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 88 - 6
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||| |||||| ||||| |
|
|
| T |
88 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccac |
6 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 434
Target Start/End: Complemental strand, 3028 - 2954
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
||||||||||||| ||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
3028 |
tgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
2954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17622 - 17704
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
17622 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac |
17704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 112110 - 112192
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||||||| |||||| || |||||| ||||| |
|
|
| T |
112110 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggtttgaatctcggatactccacttctccac |
112192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 236423 - 236332
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
|||||| |||| ||| |||| || ||||||||||| ||| ||||||| || |||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
236423 |
cgtgagattagttcagttggtagggatattgcatattat--gcaggggtcggggttcgaaccccggacaccccacttatccacattaaaatgtg |
236332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 41715 - 41628
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg |
451 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |||||||| |||| ||||| |||||||||||||| ||||| || ||||||| |
|
|
| T |
41715 |
cgtgagcttagctcaattggcagggacattgcataatttatgcagg------ggttcgaaccccggacaccccacttctccacgtttaaatgtg |
41628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Complemental strand, 266765 - 266710
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt |
413 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| |
|
|
| T |
266765 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggtt |
266710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 8893 - 8811
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| | ||||||||||||| || ||||||| ||||||| ||| || ||||| |
|
|
| T |
8893 |
cgtgagcttagctcagttggtagggatattgcatattttatgcaggggccgggggttgaaccccggacactccatttctccac |
8811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 7111 - 7182
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta |
466 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||| |||| ||| |||||| ||||||||||| |||||| |
|
|
| T |
7111 |
tatatgcaggggccggggttcgaaccccggacaccccatttattcactttaaaa-gtgaatttctagccacta |
7182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 28000 - 27916
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| ||||||||||||||| |||| || || ||||||| |||||| ||||| |
|
|
| T |
28000 |
ctcgtgagcttagctcggttggtagggatattgcattttatatgcaggggccggggttcgatccccggacactccacttctccac |
27916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 36; Significance: 0.00000000007; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 11181 - 11106
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
11106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 21509 - 21434
Alignment:
| Q |
365 |
ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac |
21434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8968 - 9050
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| |||| ||| ||||| |||| || |||||| ||||| |
|
|
| T |
8968 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccac |
9050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4082 - 4000
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| | ||||| |||||| ||||| |
|
|
| T |
4082 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccac |
4000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 15007 - 15089
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||||||| |||| || || |||||||||| |||||||||| | ||||| ||||| | ||||||||||| ||||| |
|
|
| T |
15007 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaggggtcatggttcgaaccccaaacaccccacttctccac |
15089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 18523 - 18465
Alignment:
| Q |
382 |
gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
18523 |
gatattgcatattatatacaggggccggggttcgaaccccggacaccccacttctccac |
18465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 34; Significance: 0.000000001; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 37484 - 37399
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtgg-tttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| |||| || ||||||||||| |||||||||| |||| || |||||||| |||||| |||||| ||||| |
|
|
| T |
37484 |
ctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccac |
37399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 23363 - 23443
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca |
439 |
Q |
| |
|
||||| |||| |||| |||| || ||||||||||| ||||||||| ||||| |||| ||||| ||||||| |||||| |||| |
|
|
| T |
23363 |
cgtgaacttaactcagttggtagggatattgcatattatatgcagaggccggggttcgaacc-cggacactccacttctcca |
23443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 15764 - 15848
Alignment:
| Q |
356 |
ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| |||| || |||||| ||||| |
|
|
| T |
15764 |
ctcgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccac |
15848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 419
Target Start/End: Original strand, 175 - 234
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||| |||| | ||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacc |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 419
Target Start/End: Complemental strand, 146 - 87
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc |
419 |
Q |
| |
|
||||||||||||| |||| | ||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacc |
87 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 436
Target Start/End: Original strand, 25024 - 25103
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||| ||||||| ||||||| || | ||||| || |||||||||||| | |||| ||||| |||||||||||||||| |
|
|
| T |
25024 |
cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttat |
25103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3668 - 3750
Alignment:
| Q |
358 |
cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||| |||| |||| || ||||||||||| |||||||||| || |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
3668 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggaaccagggttcgaaccccggacactccacttctccac |
3750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 363 - 429
Target Start/End: Complemental strand, 13266 - 13200
Alignment:
| Q |
363 |
gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc |
429 |
Q |
| |
|
|||||||||| |||| || ||||||||||| |||||||||||| | |||| ||||| ||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccggacaccc |
13200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 28885 - 28807
Alignment:
| Q |
362 |
agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
||||||||||| ||| || || ||| |||| | ||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
28885 |
agcttagctcagttgatagggacattacatactttatgcaggggccggggttcgaaccccggacaccccacttctccac |
28807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0276 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0276
Description:
Target: scaffold0276; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 1263 - 1344
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac |
440 |
Q |
| |
|
|||||||||||||| ||| || ||||||||| |||||| |||||||| |||| |||||||||||| |||||| ||||| |
|
|
| T |
1263 |
gtgagcttagctcagctggtaggaatattgcattttatatgtaggggccggggttcaaacctcggacactccacttctccac |
1344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 6693 - 6644
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt |
443 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||| |||| |||||| |
|
|
| T |
6693 |
tatatgcaggggccggggttcgaaccccggacaccccaattattcacctt |
6644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 22909 - 22857
Alignment:
| Q |
394 |
tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa |
447 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
22909 |
tatatgcaggggccg-ggttcgaaccctggacaccccacttattcaccttaaaa |
22857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 459
Target Start/End: Original strand, 12564 - 12664
Alignment:
| Q |
359 |
gtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc |
457 |
Q |
| |
|
|||||| ||||||| ||||||| || | ||||| || ||||||||||| | |||| |||||||||| |||||| |||| ||| |||||| ||||||||| |
|
|
| T |
12564 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttattcactttaaaa-gtgaatttc |
12662 |
T |
 |
| Q |
458 |
ta |
459 |
Q |
| |
|
|| |
|
|
| T |
12663 |
ta |
12664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 476
Target Start/End: Complemental strand, 3341 - 3224
Alignment:
| Q |
360 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttct |
458 |
Q |
| |
|
|||||||||||||||| ||| || |||| ||||||||| || ||| || | || ||| | |||||||| ||||||| | |||| |||| | |||||||| |
|
|
| T |
3341 |
tgagcttagctcaattagcatggacattgtataatatatacatgggtcgggattcgaatcccggacacctcacttattctccttaaaaaggagaatttct |
3242 |
T |
 |
| Q |
459 |
atccactatactacttga |
476 |
Q |
| |
|
| |||||| ||||||||| |
|
|
| T |
3241 |
agccactaaactacttga |
3224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 430 - 475
Target Start/End: Original strand, 55234 - 55279
Alignment:
| Q |
430 |
cacttatccaccttaaaatgtgaatttctatccactatactacttg |
475 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
55234 |
cacttattcactttaaaatgtgaatttctatctactatgctacttg |
55279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 66629 - 66580
Alignment:
| Q |
385 |
attgcataatatatgcaggggccgtggtttgaacctcggacaccccactt |
434 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||||| |||||||| ||||| |
|
|
| T |
66629 |
attgcatattatatgcaggggccggggttcgaaccccggacacctcactt |
66580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 419712 - 419789
Alignment:
| Q |
360 |
tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat |
436 |
Q |
| |
|
||||||||||||| |||| | | |||| || | ||||| ||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
419712 |
tgagcttagctcatttggtaagggataatgaacaatatgtgcaggggccggggttcgaaccccggacaccccacttat |
419789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University