View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9149_low_14 (Length: 317)
Name: NF9149_low_14
Description: NF9149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9149_low_14 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 163 - 317
Target Start/End: Original strand, 31828014 - 31828168
Alignment:
| Q |
163 |
taagagtgtttttgatttgttctgcattgtttcaaaaatggtgtgtgaccatctttgagtaatagaggatcaccaccaccatcaaaactgttatgtctct |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828014 |
taagagtgtttttgatttgttctgcattgtttcaaaaatggtgtgtgaccatctttgagtaatagaggatcaccaccaccatcaaaactgttatgtctct |
31828113 |
T |
 |
| Q |
263 |
atctctttgagtaaacacataaaaatcagaaccagagagagaaacagagaaacaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828114 |
atctctttgagtaaacacataaaaatcagaaccagagagagaaacagagaaacaa |
31828168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 22 - 105
Target Start/End: Original strand, 31827872 - 31827955
Alignment:
| Q |
22 |
aacaaaacaagttcctaagcttggttcggacattggatttgcagttaaagtcctctagagagagaccaaaactttcaaattcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31827872 |
aacaaaacaagttcctaagcttggttcggacattggatttgcagttaaagtcctctagagagagaccaaaactttcaaattcca |
31827955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University