View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9149_low_21 (Length: 254)
Name: NF9149_low_21
Description: NF9149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9149_low_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 254
Target Start/End: Complemental strand, 7710787 - 7710554
Alignment:
| Q |
14 |
attatacttgtgttcttatactttttcactgtttgacaaattttgcaggtttatttacgttatgattggaattggtgcaatccttttaatcatctcttgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7710787 |
attatacttgtgttcttatactttttcactgtttgacaaattttgcaggtttatttacgttatgattggaattggtgcaatccttttaattatctcttgt |
7710688 |
T |
|
| Q |
114 |
gtgggctatgttggaacagcattaaggagtccatgttgtttgcttactgtatcctaaattatatatgaactatgaagtgaaaataattgataaccactat |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
7710687 |
gtgggctatattggaacagcattaaggagtccatgttgtttgcttactgtatcctaaatt-------aaatatgaagtgaaaataattgataaccactat |
7710595 |
T |
|
| Q |
214 |
tgaattataggtgcaaaaagttattaaaagtaaattatttt |
254 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7710594 |
tgaattataggtgcaaaaagttgttaaaagtaaattatttt |
7710554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University