View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9149_low_24 (Length: 205)
Name: NF9149_low_24
Description: NF9149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9149_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 4082685 - 4082511
Alignment:
| Q |
17 |
ttcaattagacagagaacacaaacacaaacacaaaccaacggaagccggagccggaagaaactttcaaatttcaatggctgttgtccagactcttgaaga |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082685 |
ttcaatcagacagagaacacaaacacaaacacaaaccaatggaagccggagtcggaagaaactttcaaatttcaatggctgttgtccagactcttgaaga |
4082586 |
T |
|
| Q |
117 |
ccctcatgttgagatgagggagtgttttcagatctttgaatctatctgtgtgagagttgttatggcatttggtgc |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082585 |
ccctcatgttgagatgagggagcgttttcagatctttgaatctatctgtgtgagagttgttatggcatttggtgc |
4082511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 38 - 191
Target Start/End: Complemental strand, 4092373 - 4092220
Alignment:
| Q |
38 |
aacacaaacacaaaccaacggaagccggagccggaagaaactttcaaatttcaatggctgttgtccagactcttgaagaccctcatgttgagatgaggga |
137 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092373 |
aacacaaacacaaaccaatggaagccggagccggaagaaactttcaaatttcaatggatgttgtccagactcttgaagaccctcatgttgagatgaggga |
4092274 |
T |
|
| Q |
138 |
gtgttttcagatctttgaatctatctgtgtgagagttgttatggcatttggtgc |
191 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092273 |
gcgttttaagatctttgaatctatctgtgtgagagttgttatggcatttggtgc |
4092220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University