View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9149_low_4 (Length: 727)

Name: NF9149_low_4
Description: NF9149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9149_low_4
NF9149_low_4
[»] chr8 (153 HSPs)
chr8 (352-722)||(10557200-10557571)
chr8 (20-287)||(10557636-10557903)
chr8 (358-479)||(8402283-8402404)
chr8 (360-479)||(39164982-39165100)
chr8 (394-479)||(1588802-1588886)
chr8 (387-466)||(43508437-43508515)
chr8 (358-440)||(481013-481095)
chr8 (358-479)||(2800017-2800138)
chr8 (362-440)||(34894375-34894453)
chr8 (358-440)||(42877036-42877117)
chr8 (358-477)||(10292350-10292469)
chr8 (358-434)||(23178883-23178959)
chr8 (355-451)||(41458294-41458390)
chr8 (361-440)||(7763925-7764004)
chr8 (356-439)||(10200668-10200751)
chr8 (358-440)||(2787067-2787149)
chr8 (358-440)||(2792781-2792863)
chr8 (362-440)||(5328553-5328631)
chr8 (358-440)||(10736860-10736942)
chr8 (358-440)||(14876588-14876670)
chr8 (358-440)||(26022249-26022331)
chr8 (357-451)||(26192691-26192785)
chr8 (358-440)||(29716862-29716944)
chr8 (358-440)||(34413064-34413146)
chr8 (358-439)||(10083165-10083246)
chr8 (359-440)||(27077083-27077164)
chr8 (358-439)||(40362050-40362131)
chr8 (360-440)||(12770372-12770452)
chr8 (360-440)||(22274597-22274677)
chr8 (358-434)||(35939489-35939565)
chr8 (394-477)||(15042343-15042425)
chr8 (394-477)||(33570407-33570489)
chr8 (358-440)||(94497-94579)
chr8 (358-440)||(6280482-6280564)
chr8 (358-440)||(6659291-6659373)
chr8 (358-440)||(6739693-6739775)
chr8 (362-440)||(7816409-7816487)
chr8 (358-440)||(8034398-8034480)
chr8 (358-440)||(8265270-8265352)
chr8 (358-440)||(10568087-10568169)
chr8 (360-434)||(11231424-11231498)
chr8 (358-440)||(11875888-11875970)
chr8 (358-440)||(11890895-11890977)
chr8 (358-440)||(17027867-17027948)
chr8 (358-440)||(17072549-17072631)
chr8 (358-440)||(17558303-17558384)
chr8 (358-440)||(17575640-17575722)
chr8 (358-440)||(17698524-17698606)
chr8 (358-440)||(28909467-28909549)
chr8 (358-440)||(31712551-31712633)
chr8 (358-440)||(37717365-37717447)
chr8 (358-440)||(43656038-43656120)
chr8 (358-440)||(43856368-43856450)
chr8 (358-458)||(2696531-2696631)
chr8 (394-479)||(4798517-4798601)
chr8 (358-439)||(16432115-16432196)
chr8 (359-440)||(25890390-25890471)
chr8 (387-451)||(2908066-2908130)
chr8 (360-440)||(7194266-7194346)
chr8 (356-440)||(28420410-28420494)
chr8 (364-440)||(40393326-40393402)
chr8 (359-419)||(42006781-42006841)
chr8 (365-440)||(13647443-13647518)
chr8 (365-440)||(13747868-13747943)
chr8 (357-440)||(15856492-15856575)
chr8 (394-477)||(23239159-23239241)
chr8 (361-440)||(24480807-24480886)
chr8 (361-440)||(34266017-34266096)
chr8 (358-440)||(37708692-37708775)
chr8 (360-458)||(41454824-41454922)
chr8 (369-440)||(44444557-44444628)
chr8 (358-440)||(257541-257623)
chr8 (358-440)||(658297-658379)
chr8 (358-440)||(844033-844115)
chr8 (360-434)||(1503914-1503987)
chr8 (358-440)||(5570896-5570978)
chr8 (358-447)||(7314731-7314821)
chr8 (362-440)||(7797136-7797214)
chr8 (358-440)||(13059163-13059245)
chr8 (358-440)||(16449127-16449209)
chr8 (360-434)||(22717795-22717869)
chr8 (358-408)||(23858199-23858249)
chr8 (358-424)||(24458319-24458385)
chr8 (364-434)||(25812201-25812271)
chr8 (358-440)||(31450943-31451025)
chr8 (358-440)||(36035165-36035247)
chr8 (382-440)||(37290948-37291006)
chr8 (358-440)||(38219554-38219636)
chr8 (358-440)||(42880950-42881032)
chr8 (358-440)||(43085209-43085291)
chr8 (358-440)||(43283952-43284034)
chr8 (394-472)||(44070351-44070428)
chr8 (358-439)||(5326157-5326238)
chr8 (358-439)||(7453354-7453435)
chr8 (359-440)||(8969098-8969179)
chr8 (387-440)||(13105122-13105175)
chr8 (382-443)||(19957332-19957393)
chr8 (359-440)||(23435219-23435300)
chr8 (355-440)||(38344048-38344133)
chr8 (358-427)||(38955193-38955262)
chr8 (358-447)||(39362267-39362356)
chr8 (358-451)||(41616341-41616434)
chr8 (358-407)||(41689884-41689933)
chr8 (358-434)||(1937312-1937388)
chr8 (358-434)||(4615668-4615744)
chr8 (392-436)||(8350469-8350513)
chr8 (358-434)||(8698572-8698648)
chr8 (396-444)||(11822999-11823047)
chr8 (357-405)||(22437811-22437859)
chr8 (358-434)||(23339888-23339964)
chr8 (359-439)||(30300332-30300412)
chr8 (366-477)||(35301141-35301252)
chr8 (358-405)||(12246-12293)
chr8 (363-434)||(7109283-7109353)
chr8 (387-446)||(14583228-14583287)
chr8 (394-477)||(36359696-36359778)
chr8 (358-440)||(38745264-38745347)
chr8 (382-440)||(1337101-1337159)
chr8 (362-440)||(5683760-5683838)
chr8 (382-440)||(6942517-6942575)
chr8 (382-440)||(9370194-9370252)
chr8 (358-440)||(10573103-10573185)
chr8 (358-440)||(11872068-11872150)
chr8 (358-440)||(13406602-13406684)
chr8 (394-436)||(17980317-17980359)
chr8 (394-479)||(28378847-28378932)
chr8 (358-440)||(29514628-29514710)
chr8 (358-440)||(30972804-30972885)
chr8 (386-440)||(31406787-31406841)
chr8 (359-466)||(31802863-31802966)
chr8 (358-404)||(32719629-32719675)
chr8 (358-440)||(34158643-34158725)
chr8 (394-440)||(34873124-34873170)
chr8 (361-439)||(37524194-37524272)
chr8 (358-440)||(38283126-38283208)
chr8 (382-440)||(40740551-40740608)
chr8 (358-440)||(43186855-43186937)
chr8 (358-431)||(2294094-2294167)
chr8 (383-440)||(3912150-3912207)
chr8 (394-455)||(5184886-5184947)
chr8 (359-440)||(5332919-5333000)
chr8 (359-440)||(8862112-8862193)
chr8 (394-455)||(9524992-9525053)
chr8 (359-440)||(10030415-10030496)
chr8 (394-455)||(10199741-10199802)
chr8 (394-455)||(13702351-13702412)
chr8 (394-447)||(14011045-14011098)
chr8 (394-443)||(17467313-17467361)
chr8 (394-455)||(17987448-17987509)
chr8 (394-455)||(24608482-24608543)
chr8 (394-455)||(30942598-30942659)
chr8 (362-407)||(37838583-37838628)
chr8 (359-440)||(38620327-38620408)
[»] chr3 (167 HSPs)
chr3 (358-479)||(36763431-36763553)
chr3 (358-479)||(9624981-9625102)
chr3 (358-440)||(24303392-24303474)
chr3 (361-451)||(43280073-43280163)
chr3 (356-440)||(17602662-17602746)
chr3 (360-451)||(49443398-49443489)
chr3 (358-440)||(19222572-19222654)
chr3 (358-479)||(27183657-27183778)
chr3 (358-440)||(32256540-32256622)
chr3 (358-440)||(34102597-34102679)
chr3 (358-440)||(39719937-39720019)
chr3 (362-440)||(41936393-41936471)
chr3 (358-466)||(24559387-24559495)
chr3 (358-451)||(46844946-46845039)
chr3 (356-440)||(11436504-11436588)
chr3 (356-440)||(30779553-30779637)
chr3 (358-477)||(36331704-36331823)
chr3 (358-434)||(53163596-53163672)
chr3 (359-434)||(15975155-15975230)
chr3 (360-479)||(45118644-45118763)
chr3 (358-440)||(4139002-4139084)
chr3 (358-440)||(25954780-25954862)
chr3 (358-440)||(29373435-29373517)
chr3 (358-440)||(31327704-31327786)
chr3 (358-440)||(37800597-37800679)
chr3 (358-440)||(40933817-40933899)
chr3 (358-440)||(44651968-44652050)
chr3 (358-440)||(47098734-47098816)
chr3 (358-440)||(50496800-50496882)
chr3 (359-440)||(53432723-53432804)
chr3 (356-440)||(25279045-25279129)
chr3 (359-434)||(32776214-32776289)
chr3 (358-440)||(2522928-2523010)
chr3 (358-440)||(6919949-6920031)
chr3 (358-440)||(9176572-9176654)
chr3 (358-440)||(10176889-10176971)
chr3 (366-440)||(10952291-10952365)
chr3 (394-456)||(17439963-17440025)
chr3 (358-440)||(18194340-18194422)
chr3 (358-440)||(22472300-22472382)
chr3 (358-440)||(22501917-22501999)
chr3 (385-451)||(23653191-23653257)
chr3 (358-440)||(31327487-31327569)
chr3 (358-440)||(33706713-33706795)
chr3 (358-440)||(34898753-34898835)
chr3 (358-440)||(37488446-37488528)
chr3 (358-440)||(39966060-39966142)
chr3 (358-440)||(40548305-40548387)
chr3 (358-440)||(45701346-45701428)
chr3 (358-440)||(48739730-48739812)
chr3 (358-440)||(50234126-50234208)
chr3 (358-440)||(52974039-52974121)
chr3 (358-440)||(54769816-54769898)
chr3 (358-458)||(166786-166886)
chr3 (358-466)||(14868683-14868791)
chr3 (394-455)||(24537862-24537923)
chr3 (358-431)||(28550314-28550387)
chr3 (394-455)||(46328923-46328984)
chr3 (394-455)||(50724402-50724463)
chr3 (394-455)||(50788385-50788446)
chr3 (382-434)||(5641606-5641658)
chr3 (360-440)||(6488128-6488208)
chr3 (358-477)||(10959131-10959250)
chr3 (374-446)||(17003820-17003892)
chr3 (360-440)||(17218492-17218572)
chr3 (362-434)||(26942759-26942831)
chr3 (360-440)||(29559660-29559740)
chr3 (360-440)||(31586951-31587031)
chr3 (365-440)||(38949683-38949758)
chr3 (358-472)||(3955304-3955420)
chr3 (358-440)||(4860163-4860245)
chr3 (358-440)||(7269957-7270039)
chr3 (358-440)||(7920322-7920404)
chr3 (419-477)||(12100116-12100174)
chr3 (358-440)||(14795113-14795195)
chr3 (358-440)||(17608305-17608387)
chr3 (358-440)||(28689658-28689740)
chr3 (358-479)||(29098694-29098816)
chr3 (358-440)||(31528944-31529026)
chr3 (358-440)||(32144586-32144668)
chr3 (358-440)||(33606926-33607007)
chr3 (366-440)||(49447148-49447222)
chr3 (361-459)||(49593919-49594017)
chr3 (358-440)||(52309096-52309178)
chr3 (358-440)||(52410227-52410309)
chr3 (358-440)||(52945897-52945978)
chr3 (358-440)||(53347276-53347358)
chr3 (358-439)||(4227731-4227812)
chr3 (359-440)||(5636785-5636866)
chr3 (358-439)||(9684998-9685079)
chr3 (358-419)||(19999869-19999930)
chr3 (360-429)||(20489819-20489888)
chr3 (394-443)||(24130594-24130643)
chr3 (387-440)||(25883974-25884027)
chr3 (394-443)||(27394542-27394591)
chr3 (394-455)||(33206792-33206853)
chr3 (394-455)||(43566795-43566856)
chr3 (356-440)||(44764722-44764804)
chr3 (358-419)||(46795936-46795997)
chr3 (359-440)||(48251575-48251656)
chr3 (394-479)||(52030156-52030240)
chr3 (359-440)||(53577958-53578039)
chr3 (359-439)||(3614067-3614147)
chr3 (362-434)||(4640472-4640544)
chr3 (396-479)||(24136726-24136810)
chr3 (360-432)||(28951720-28951792)
chr3 (356-443)||(40160732-40160819)
chr3 (358-434)||(48546175-48546251)
chr3 (360-440)||(51155078-51155158)
chr3 (393-477)||(54983683-54983766)
chr3 (356-419)||(2368936-2368999)
chr3 (396-455)||(2732700-2732759)
chr3 (394-479)||(3993681-3993767)
chr3 (358-413)||(8125641-8125696)
chr3 (357-420)||(11250597-11250660)
chr3 (365-440)||(42108168-42108243)
chr3 (358-440)||(46336488-46336571)
chr3 (359-434)||(52984013-52984088)
chr3 (365-440)||(54408536-54408611)
chr3 (358-440)||(882391-882473)
chr3 (358-440)||(3748588-3748670)
chr3 (358-440)||(3894546-3894628)
chr3 (394-479)||(4009992-4010078)
chr3 (358-432)||(4236974-4237047)
chr3 (358-440)||(4880171-4880253)
chr3 (362-447)||(7517942-7518028)
chr3 (358-440)||(10482839-10482921)
chr3 (358-440)||(17728994-17729075)
chr3 (358-440)||(19030223-19030304)
chr3 (358-440)||(19996438-19996520)
chr3 (394-436)||(24751278-24751320)
chr3 (362-440)||(25833829-25833906)
chr3 (385-451)||(26880206-26880272)
chr3 (394-440)||(27329918-27329964)
chr3 (382-436)||(32421371-32421425)
chr3 (358-440)||(32828443-32828525)
chr3 (358-440)||(33225334-33225416)
chr3 (358-479)||(36476357-36476478)
chr3 (358-440)||(40192158-40192240)
chr3 (394-440)||(44625211-44625257)
chr3 (358-440)||(45551795-45551877)
chr3 (394-472)||(49146119-49146196)
chr3 (357-466)||(49750365-49750475)
chr3 (356-434)||(50659590-50659668)
chr3 (359-429)||(51772892-51772962)
chr3 (394-440)||(51879133-51879179)
chr3 (394-444)||(53467984-53468033)
chr3 (362-440)||(54349826-54349904)
chr3 (394-443)||(3973337-3973386)
chr3 (394-443)||(3996490-3996539)
chr3 (394-447)||(6951798-6951850)
chr3 (394-455)||(14417903-14417964)
chr3 (359-440)||(16886585-16886666)
chr3 (358-403)||(19550508-19550553)
chr3 (358-419)||(25938937-25938998)
chr3 (359-440)||(27983858-27983939)
chr3 (391-436)||(29645845-29645890)
chr3 (410-447)||(31680783-31680820)
chr3 (394-455)||(31698568-31698629)
chr3 (394-455)||(32508793-32508854)
chr3 (394-455)||(42271012-42271073)
chr3 (394-455)||(43774220-43774281)
chr3 (357-434)||(45647304-45647381)
chr3 (358-427)||(45871019-45871088)
chr3 (366-451)||(46817326-46817411)
chr3 (358-403)||(50536855-50536900)
chr3 (391-436)||(54295238-54295283)
[»] chr4 (162 HSPs)
chr4 (358-440)||(42044032-42044114)
chr4 (358-450)||(11294814-11294906)
chr4 (358-479)||(9692960-9693081)
chr4 (358-440)||(22788660-22788742)
chr4 (358-479)||(42411429-42411551)
chr4 (358-440)||(51890799-51890881)
chr4 (358-434)||(8965096-8965172)
chr4 (357-440)||(29771285-29771368)
chr4 (361-451)||(38848095-38848186)
chr4 (358-440)||(3036041-3036123)
chr4 (362-440)||(21935483-21935561)
chr4 (358-479)||(28520707-28520828)
chr4 (360-477)||(29584648-29584765)
chr4 (358-440)||(42002308-42002390)
chr4 (358-440)||(49901484-49901566)
chr4 (368-451)||(40486453-40486536)
chr4 (362-440)||(2629585-2629663)
chr4 (358-440)||(4234271-4234353)
chr4 (358-440)||(11375875-11375957)
chr4 (358-440)||(13578451-13578533)
chr4 (358-440)||(33933725-33933807)
chr4 (358-440)||(43147370-43147452)
chr4 (358-440)||(43596897-43596979)
chr4 (358-440)||(46105537-46105619)
chr4 (358-440)||(46775016-46775098)
chr4 (358-440)||(47934058-47934140)
chr4 (358-440)||(55251337-55251419)
chr4 (366-466)||(14149799-14149899)
chr4 (358-439)||(31852351-31852432)
chr4 (358-466)||(48968199-48968307)
chr4 (358-434)||(6371116-6371192)
chr4 (356-479)||(8690210-8690333)
chr4 (358-434)||(22230426-22230502)
chr4 (359-476)||(46206580-46206705)
chr4 (358-477)||(52031205-52031324)
chr4 (358-434)||(55238491-55238567)
chr4 (361-440)||(53376665-53376744)
chr4 (358-440)||(3847683-3847765)
chr4 (358-440)||(7686248-7686330)
chr4 (358-440)||(26868351-26868432)
chr4 (358-440)||(34353781-34353863)
chr4 (358-440)||(39023177-39023259)
chr4 (358-440)||(45139867-45139949)
chr4 (358-440)||(48569162-48569244)
chr4 (358-440)||(50457700-50457782)
chr4 (393-479)||(52330885-52330970)
chr4 (358-479)||(53815694-53815815)
chr4 (362-440)||(56087940-56088018)
chr4 (358-451)||(3784914-3785006)
chr4 (359-451)||(8848186-8848279)
chr4 (394-455)||(24234073-24234134)
chr4 (359-440)||(29406360-29406441)
chr4 (359-440)||(42395230-42395311)
chr4 (358-439)||(45112098-45112179)
chr4 (394-455)||(47017945-47018006)
chr4 (394-466)||(32885723-32885794)
chr4 (358-434)||(55853100-55853176)
chr4 (360-477)||(25780513-25780632)
chr4 (396-455)||(36257731-36257790)
chr4 (355-434)||(56479219-56479297)
chr4 (353-455)||(56546448-56546550)
chr4 (358-440)||(542800-542882)
chr4 (394-456)||(548885-548947)
chr4 (358-440)||(637101-637183)
chr4 (362-440)||(1458004-1458082)
chr4 (382-440)||(2222565-2222623)
chr4 (394-472)||(3465618-3465695)
chr4 (358-440)||(4958542-4958624)
chr4 (358-440)||(10402443-10402525)
chr4 (385-451)||(13088938-13089004)
chr4 (360-434)||(13264266-13264340)
chr4 (358-440)||(18360495-18360577)
chr4 (393-443)||(21765420-21765470)
chr4 (358-440)||(23924858-23924940)
chr4 (358-440)||(25235783-25235865)
chr4 (358-440)||(27362815-27362897)
chr4 (366-440)||(30057232-30057306)
chr4 (358-455)||(36008273-36008371)
chr4 (358-440)||(36132231-36132313)
chr4 (358-440)||(36602352-36602434)
chr4 (358-440)||(37251115-37251197)
chr4 (358-440)||(40051624-40051706)
chr4 (358-440)||(42381099-42381181)
chr4 (358-440)||(43978010-43978091)
chr4 (358-440)||(49264528-49264610)
chr4 (358-440)||(52757264-52757346)
chr4 (358-440)||(55055918-55056000)
chr4 (358-440)||(55536382-55536463)
chr4 (382-443)||(6930577-6930638)
chr4 (358-478)||(15640420-15640540)
chr4 (358-439)||(17872089-17872170)
chr4 (357-434)||(20203427-20203504)
chr4 (361-434)||(25224477-25224550)
chr4 (358-439)||(27308692-27308773)
chr4 (360-436)||(38690666-38690743)
chr4 (394-479)||(40150508-40150592)
chr4 (359-440)||(42081738-42081819)
chr4 (358-419)||(44602487-44602548)
chr4 (359-440)||(46582637-46582718)
chr4 (383-440)||(47929272-47929329)
chr4 (394-455)||(53697979-53698040)
chr4 (356-440)||(12504629-12504713)
chr4 (387-431)||(15334817-15334861)
chr4 (360-440)||(21863871-21863951)
chr4 (360-440)||(21919732-21919812)
chr4 (358-406)||(24680106-24680154)
chr4 (358-434)||(26919460-26919536)
chr4 (358-406)||(30217601-30217649)
chr4 (358-406)||(37935863-37935911)
chr4 (356-439)||(33530793-33530876)
chr4 (358-440)||(36099169-36099252)
chr4 (358-459)||(36954134-36954236)
chr4 (358-405)||(41621288-41621335)
chr4 (358-440)||(49056776-49056859)
chr4 (360-451)||(50512364-50512455)
chr4 (358-477)||(54854155-54854275)
chr4 (358-440)||(624482-624564)
chr4 (382-440)||(2275072-2275130)
chr4 (358-440)||(3763994-3764076)
chr4 (358-440)||(3815062-3815144)
chr4 (358-440)||(4590248-4590330)
chr4 (358-440)||(5165859-5165940)
chr4 (382-440)||(5179868-5179926)
chr4 (358-440)||(5304996-5305078)
chr4 (352-477)||(9285637-9285761)
chr4 (358-440)||(9761117-9761199)
chr4 (382-440)||(12582014-12582072)
chr4 (358-455)||(12820404-12820502)
chr4 (358-440)||(15604026-15604108)
chr4 (382-440)||(17616966-17617024)
chr4 (358-440)||(23705139-23705221)
chr4 (394-444)||(31601841-31601891)
chr4 (358-440)||(35219487-35219568)
chr4 (394-477)||(35230271-35230355)
chr4 (382-440)||(37868553-37868611)
chr4 (382-440)||(41897533-41897591)
chr4 (359-401)||(43027292-43027334)
chr4 (358-440)||(43271703-43271785)
chr4 (358-440)||(43481026-43481107)
chr4 (358-440)||(45126134-45126216)
chr4 (358-440)||(45849049-45849131)
chr4 (358-440)||(51511995-51512077)
chr4 (359-440)||(626968-627049)
chr4 (382-451)||(2688122-2688191)
chr4 (394-447)||(7768795-7768848)
chr4 (382-451)||(9477411-9477480)
chr4 (394-479)||(9924891-9924975)
chr4 (394-479)||(10098160-10098244)
chr4 (382-427)||(19963808-19963853)
chr4 (394-447)||(20610774-20610827)
chr4 (360-436)||(26885418-26885495)
chr4 (359-440)||(29256974-29257055)
chr4 (394-447)||(33076565-33076618)
chr4 (394-455)||(34773682-34773743)
chr4 (394-455)||(37032178-37032239)
chr4 (358-403)||(43207671-43207716)
chr4 (359-440)||(46998354-46998435)
chr4 (358-478)||(48512197-48512317)
chr4 (358-451)||(51777846-51777939)
chr4 (397-466)||(53354955-53355023)
chr4 (359-440)||(55260299-55260380)
chr4 (394-443)||(56555583-56555632)
[»] chr5 (107 HSPs)
chr5 (356-440)||(17064844-17064928)
chr5 (358-440)||(1269153-1269235)
chr5 (358-479)||(6447456-6447577)
chr5 (358-440)||(12891559-12891641)
chr5 (358-440)||(13621932-13622014)
chr5 (358-439)||(17545159-17545240)
chr5 (356-479)||(4674791-4674914)
chr5 (359-464)||(1463870-1463975)
chr5 (358-440)||(4417671-4417753)
chr5 (358-479)||(5966831-5966952)
chr5 (358-440)||(6558803-6558885)
chr5 (358-440)||(8968751-8968833)
chr5 (358-440)||(9125665-9125746)
chr5 (358-440)||(9835035-9835117)
chr5 (358-440)||(12463758-12463840)
chr5 (358-440)||(14641095-14641177)
chr5 (358-440)||(15241398-15241480)
chr5 (358-440)||(24477827-24477909)
chr5 (358-440)||(32505690-32505772)
chr5 (358-440)||(42916391-42916473)
chr5 (360-440)||(8241054-8241134)
chr5 (364-440)||(20145550-20145626)
chr5 (361-440)||(24033082-24033161)
chr5 (358-440)||(3198329-3198411)
chr5 (358-440)||(4745862-4745944)
chr5 (358-440)||(6518762-6518844)
chr5 (358-440)||(11897250-11897332)
chr5 (358-440)||(23155895-23155977)
chr5 (358-440)||(23292403-23292485)
chr5 (358-455)||(32158413-32158510)
chr5 (358-440)||(35515514-35515596)
chr5 (358-440)||(41179789-41179871)
chr5 (358-440)||(42525402-42525484)
chr5 (394-455)||(10943751-10943812)
chr5 (359-440)||(18928723-18928804)
chr5 (359-440)||(25400353-25400434)
chr5 (383-440)||(32226231-32226288)
chr5 (358-434)||(546804-546880)
chr5 (358-434)||(1743129-1743204)
chr5 (360-440)||(17175037-17175117)
chr5 (358-450)||(26912835-26912927)
chr5 (361-440)||(18638603-18638682)
chr5 (358-440)||(2328594-2328676)
chr5 (358-440)||(4067984-4068066)
chr5 (358-440)||(5900294-5900375)
chr5 (394-436)||(6614056-6614098)
chr5 (397-455)||(8015873-8015931)
chr5 (358-440)||(11774445-11774527)
chr5 (366-479)||(20735151-20735264)
chr5 (358-440)||(21918054-21918136)
chr5 (358-440)||(27765259-27765341)
chr5 (358-440)||(36888381-36888463)
chr5 (358-432)||(39919087-39919161)
chr5 (358-440)||(43580880-43580962)
chr5 (358-451)||(27241643-27241736)
chr5 (394-455)||(30403785-30403846)
chr5 (352-401)||(30819226-30819275)
chr5 (360-436)||(31250147-31250224)
chr5 (394-455)||(33729813-33729874)
chr5 (394-459)||(36045130-36045194)
chr5 (360-436)||(38503275-38503352)
chr5 (394-455)||(38618680-38618741)
chr5 (360-436)||(43227866-43227943)
chr5 (360-440)||(16386727-16386807)
chr5 (395-455)||(19059003-19059063)
chr5 (394-466)||(25346219-25346290)
chr5 (356-432)||(36564416-36564492)
chr5 (360-440)||(36716844-36716924)
chr5 (358-405)||(18049642-18049689)
chr5 (353-455)||(18477997-18478099)
chr5 (358-429)||(24456192-24456262)
chr5 (361-440)||(33018512-33018590)
chr5 (373-440)||(37553911-37553978)
chr5 (357-440)||(40276428-40276511)
chr5 (385-447)||(7064777-7064839)
chr5 (394-456)||(7631055-7631117)
chr5 (362-440)||(13876307-13876385)
chr5 (396-466)||(16263775-16263845)
chr5 (394-440)||(17891845-17891891)
chr5 (374-440)||(18050197-18050263)
chr5 (358-404)||(19985502-19985548)
chr5 (358-440)||(25729426-25729508)
chr5 (358-440)||(32706324-32706406)
chr5 (394-444)||(33800928-33800978)
chr5 (358-440)||(35241398-35241479)
chr5 (358-440)||(36124401-36124483)
chr5 (358-440)||(39800016-39800098)
chr5 (358-440)||(39886198-39886280)
chr5 (358-440)||(40091479-40091561)
chr5 (358-440)||(42320319-42320401)
chr5 (410-479)||(42355724-42355794)
chr5 (394-447)||(3535943-3535996)
chr5 (355-404)||(6414067-6414116)
chr5 (358-419)||(8478900-8478961)
chr5 (382-439)||(13958408-13958465)
chr5 (394-447)||(18101956-18102009)
chr5 (394-455)||(20945890-20945951)
chr5 (358-419)||(25648092-25648153)
chr5 (394-455)||(29096307-29096368)
chr5 (359-440)||(29154846-29154926)
chr5 (356-413)||(34436848-34436905)
chr5 (382-443)||(34729495-34729555)
chr5 (360-433)||(37034810-37034883)
chr5 (358-466)||(37417119-37417226)
chr5 (355-408)||(39028051-39028104)
chr5 (358-415)||(41127021-41127078)
chr5 (394-455)||(42455393-42455454)
[»] chr6 (97 HSPs)
chr6 (358-477)||(6658521-6658639)
chr6 (358-440)||(2251840-2251922)
chr6 (358-440)||(32166371-32166453)
chr6 (356-440)||(3640514-3640598)
chr6 (358-440)||(492904-492986)
chr6 (358-440)||(7865341-7865423)
chr6 (358-440)||(8297629-8297711)
chr6 (358-440)||(15091450-15091532)
chr6 (358-459)||(20568251-20568353)
chr6 (359-440)||(216209-216290)
chr6 (358-434)||(3294766-3294842)
chr6 (394-477)||(6530182-6530264)
chr6 (358-440)||(7545331-7545413)
chr6 (358-440)||(9435628-9435710)
chr6 (358-440)||(10934601-10934683)
chr6 (358-440)||(17441825-17441907)
chr6 (358-440)||(19953814-19953896)
chr6 (355-440)||(743562-743647)
chr6 (358-466)||(14981691-14981799)
chr6 (358-430)||(1968998-1969070)
chr6 (360-440)||(32611540-32611620)
chr6 (365-451)||(5694923-5695009)
chr6 (358-440)||(7207846-7207928)
chr6 (358-479)||(9064864-9064985)
chr6 (358-440)||(9372187-9372269)
chr6 (358-440)||(29284268-29284350)
chr6 (358-440)||(30704962-30705044)
chr6 (358-440)||(31705901-31705983)
chr6 (358-440)||(31802055-31802137)
chr6 (358-440)||(33573819-33573901)
chr6 (394-443)||(7234000-7234049)
chr6 (358-440)||(19618712-19618796)
chr6 (359-440)||(28030867-28030948)
chr6 (358-451)||(31104884-31104977)
chr6 (359-440)||(31935102-31935183)
chr6 (360-440)||(2816894-2816974)
chr6 (358-477)||(30938390-30938510)
chr6 (365-440)||(3795760-3795835)
chr6 (358-433)||(5052066-5052141)
chr6 (394-477)||(22983615-22983697)
chr6 (394-477)||(23804711-23804793)
chr6 (360-439)||(32670041-32670120)
chr6 (358-440)||(606989-607071)
chr6 (358-440)||(978120-978202)
chr6 (358-455)||(3448350-3448448)
chr6 (358-440)||(3794159-3794241)
chr6 (358-432)||(4408360-4408434)
chr6 (358-440)||(6210056-6210138)
chr6 (358-440)||(7177297-7177379)
chr6 (358-439)||(7897105-7897187)
chr6 (358-440)||(9246368-9246450)
chr6 (358-440)||(10483522-10483604)
chr6 (358-440)||(10517201-10517283)
chr6 (358-428)||(16406571-16406641)
chr6 (358-440)||(17454731-17454813)
chr6 (394-444)||(19279484-19279534)
chr6 (358-440)||(19892262-19892344)
chr6 (358-440)||(22997338-22997420)
chr6 (358-440)||(23790981-23791063)
chr6 (358-440)||(24319015-24319097)
chr6 (387-429)||(32502215-32502257)
chr6 (394-455)||(5134433-5134494)
chr6 (360-436)||(6228278-6228355)
chr6 (358-419)||(8857092-8857153)
chr6 (394-455)||(12089132-12089193)
chr6 (360-436)||(18903385-18903462)
chr6 (394-455)||(25020527-25020588)
chr6 (356-440)||(28237237-28237322)
chr6 (387-443)||(32470712-32470769)
chr6 (359-439)||(361166-361246)
chr6 (358-418)||(4869706-4869766)
chr6 (359-451)||(11420962-11421053)
chr6 (360-440)||(15963929-15964009)
chr6 (364-440)||(28148719-28148795)
chr6 (358-434)||(32813642-32813718)
chr6 (358-405)||(8439677-8439724)
chr6 (359-477)||(16119280-16119398)
chr6 (382-440)||(33646860-33646919)
chr6 (394-477)||(4844178-4844262)
chr6 (358-440)||(6419069-6419150)
chr6 (360-434)||(7153792-7153866)
chr6 (357-407)||(7418279-7418329)
chr6 (394-444)||(9491745-9491795)
chr6 (394-444)||(10424545-10424595)
chr6 (358-440)||(10628616-10628698)
chr6 (394-448)||(22730708-22730762)
chr6 (394-444)||(26528602-26528652)
chr6 (394-440)||(27667198-27667244)
chr6 (358-440)||(30885556-30885638)
chr6 (358-439)||(3298954-3299035)
chr6 (360-436)||(4854324-4854401)
chr6 (358-419)||(9704419-9704480)
chr6 (394-455)||(12101921-12101982)
chr6 (394-455)||(16251522-16251583)
chr6 (394-443)||(24256951-24257000)
chr6 (358-439)||(28222865-28222945)
chr6 (359-440)||(32283541-32283622)
[»] scaffold0088 (1 HSPs)
scaffold0088 (358-440)||(10812-10894)
[»] chr7 (119 HSPs)
chr7 (358-440)||(9877253-9877335)
chr7 (358-440)||(23102544-23102626)
chr7 (360-450)||(27788273-27788363)
chr7 (360-450)||(27791429-27791519)
chr7 (358-479)||(29658248-29658369)
chr7 (358-440)||(27424841-27424923)
chr7 (358-439)||(15238891-15238972)
chr7 (358-451)||(22774042-22774135)
chr7 (355-440)||(30388493-30388578)
chr7 (358-466)||(42352652-42352760)
chr7 (358-472)||(31475823-31475937)
chr7 (358-440)||(2228977-2229059)
chr7 (358-440)||(9712184-9712266)
chr7 (358-440)||(10244875-10244957)
chr7 (358-440)||(19752954-19753036)
chr7 (358-440)||(29617407-29617489)
chr7 (358-440)||(36174392-36174474)
chr7 (359-475)||(8859716-8859833)
chr7 (394-455)||(14102496-14102557)
chr7 (394-455)||(14412513-14412574)
chr7 (359-440)||(48119473-48119554)
chr7 (360-475)||(8858661-8858777)
chr7 (359-427)||(13730096-13730164)
chr7 (360-440)||(28805304-28805384)
chr7 (360-440)||(32676928-32677008)
chr7 (365-440)||(9497975-9498050)
chr7 (353-479)||(22965934-22966059)
chr7 (360-458)||(27454011-27454110)
chr7 (358-444)||(36315984-36316070)
chr7 (359-434)||(36931976-36932051)
chr7 (368-434)||(1563731-1563797)
chr7 (358-440)||(3766813-3766895)
chr7 (358-440)||(12640575-12640657)
chr7 (358-455)||(21285352-21285450)
chr7 (358-440)||(24781032-24781114)
chr7 (394-479)||(25711106-25711191)
chr7 (358-440)||(31026221-31026303)
chr7 (358-440)||(35950130-35950212)
chr7 (358-440)||(36391890-36391972)
chr7 (358-440)||(41331065-41331147)
chr7 (358-440)||(42443691-42443773)
chr7 (394-455)||(4169111-4169172)
chr7 (358-439)||(23755001-23755082)
chr7 (359-440)||(37411723-37411804)
chr7 (393-466)||(47225195-47225268)
chr7 (359-440)||(48413912-48413993)
chr7 (360-440)||(35612553-35612633)
chr7 (356-419)||(3532578-3532641)
chr7 (356-439)||(12772115-12772198)
chr7 (382-440)||(1398889-1398947)
chr7 (358-440)||(2681098-2681180)
chr7 (360-450)||(15716661-15716751)
chr7 (358-440)||(21066888-21066970)
chr7 (358-440)||(23274800-23274882)
chr7 (358-440)||(24061315-24061397)
chr7 (358-440)||(24188472-24188554)
chr7 (358-440)||(25833557-25833639)
chr7 (394-444)||(27047725-27047775)
chr7 (358-440)||(28444068-28444150)
chr7 (358-440)||(30806117-30806199)
chr7 (358-440)||(30940773-30940855)
chr7 (382-436)||(38378242-38378296)
chr7 (358-479)||(41417251-41417372)
chr7 (362-440)||(41465840-41465918)
chr7 (358-440)||(41853999-41854081)
chr7 (358-440)||(44616604-44616686)
chr7 (358-440)||(47463933-47464015)
chr7 (358-440)||(47641047-47641129)
chr7 (394-455)||(5787496-5787557)
chr7 (359-440)||(16200562-16200643)
chr7 (363-440)||(18503466-18503543)
chr7 (358-439)||(36469692-36469773)
chr7 (358-419)||(37300106-37300167)
chr7 (359-440)||(38151347-38151428)
chr7 (394-479)||(38451898-38451982)
chr7 (360-436)||(40273821-40273898)
chr7 (358-419)||(41084041-41084102)
chr7 (358-427)||(47255081-47255150)
chr7 (360-432)||(21388527-21388599)
chr7 (395-455)||(34948142-34948202)
chr7 (358-477)||(41139085-41139204)
chr7 (358-434)||(45284811-45284887)
chr7 (356-440)||(48447749-48447833)
chr7 (373-440)||(10646182-10646249)
chr7 (358-444)||(11808037-11808123)
chr7 (360-474)||(21461631-21461746)
chr7 (358-413)||(27510270-27510325)
chr7 (358-413)||(36622176-36622231)
chr7 (387-446)||(47440790-47440849)
chr7 (358-455)||(2261483-2261580)
chr7 (412-477)||(3948107-3948173)
chr7 (358-435)||(7465465-7465542)
chr7 (365-439)||(13720779-13720853)
chr7 (382-440)||(14204298-14204356)
chr7 (362-440)||(24880438-24880516)
chr7 (394-456)||(27907894-27907956)
chr7 (353-435)||(28479319-28479401)
chr7 (359-413)||(31762002-31762056)
chr7 (382-440)||(32047115-32047173)
chr7 (358-440)||(32074381-32074463)
chr7 (358-440)||(32856903-32856985)
chr7 (358-440)||(34267537-34267619)
chr7 (358-440)||(35683113-35683195)
chr7 (358-440)||(38889479-38889561)
chr7 (370-440)||(39956387-39956457)
chr7 (394-472)||(42887189-42887266)
chr7 (394-436)||(44437843-44437885)
chr7 (358-432)||(48288395-48288469)
chr7 (359-440)||(15106677-15106758)
chr7 (394-479)||(17900855-17900939)
chr7 (394-459)||(19126772-19126836)
chr7 (385-434)||(27425117-27425166)
chr7 (382-446)||(28914885-28914950)
chr7 (394-455)||(30644204-30644265)
chr7 (394-455)||(33202553-33202614)
chr7 (394-455)||(37449509-37449570)
chr7 (394-455)||(45011657-45011718)
chr7 (358-439)||(47999782-47999863)
chr7 (360-436)||(48433728-48433805)
[»] chr2 (106 HSPs)
chr2 (362-440)||(1844823-1844901)
chr2 (358-459)||(23405198-23405300)
chr2 (358-440)||(33228919-33229001)
chr2 (359-440)||(5612957-5613038)
chr2 (358-476)||(29034974-29035092)
chr2 (356-439)||(44857221-44857304)
chr2 (358-440)||(3446732-3446814)
chr2 (358-440)||(20919612-20919694)
chr2 (358-440)||(34613981-34614063)
chr2 (358-440)||(40473536-40473618)
chr2 (358-440)||(40535435-40535517)
chr2 (358-440)||(41509518-41509600)
chr2 (358-439)||(1964355-1964436)
chr2 (359-440)||(3287042-3287123)
chr2 (356-440)||(44666329-44666413)
chr2 (361-440)||(3596255-3596334)
chr2 (358-440)||(2643699-2643781)
chr2 (358-440)||(4562738-4562820)
chr2 (358-440)||(4878211-4878293)
chr2 (358-440)||(5521206-5521288)
chr2 (358-408)||(15233415-15233465)
chr2 (358-440)||(17034737-17034819)
chr2 (358-440)||(19281610-19281692)
chr2 (358-440)||(22653630-22653712)
chr2 (358-440)||(36182644-36182726)
chr2 (358-479)||(44187702-44187823)
chr2 (394-455)||(3037621-3037682)
chr2 (358-419)||(8250308-8250369)
chr2 (358-439)||(11050744-11050825)
chr2 (358-430)||(5474908-5474980)
chr2 (356-440)||(13242717-13242801)
chr2 (360-440)||(28194636-28194716)
chr2 (360-440)||(31223624-31223704)
chr2 (395-455)||(34018069-34018129)
chr2 (360-440)||(35367415-35367495)
chr2 (394-466)||(36665465-36665536)
chr2 (356-439)||(28195121-28195204)
chr2 (365-440)||(30390355-30390430)
chr2 (394-444)||(580793-580843)
chr2 (358-440)||(1071472-1071554)
chr2 (358-479)||(2304288-2304409)
chr2 (358-440)||(3438950-3439032)
chr2 (358-440)||(4183178-4183260)
chr2 (358-440)||(6331564-6331645)
chr2 (394-444)||(17154684-17154734)
chr2 (358-440)||(18278403-18278485)
chr2 (358-440)||(20296420-20296502)
chr2 (358-440)||(25857281-25857363)
chr2 (358-404)||(27913491-27913537)
chr2 (394-440)||(32221005-32221051)
chr2 (358-440)||(36005444-36005526)
chr2 (358-408)||(38400312-38400362)
chr2 (382-440)||(44186469-44186527)
chr2 (394-455)||(3179359-3179420)
chr2 (394-455)||(8234791-8234852)
chr2 (394-455)||(11133111-11133172)
chr2 (356-405)||(15764930-15764979)
chr2 (394-455)||(30474194-30474255)
chr2 (361-434)||(32189994-32190067)
chr2 (366-462)||(32527070-32527166)
chr2 (387-436)||(33482660-33482709)
chr2 (359-432)||(38179239-38179312)
chr2 (394-455)||(44721703-44721764)
chr2 (358-419)||(44948598-44948659)
chr2 (359-427)||(6635966-6636034)
chr2 (353-472)||(22297435-22297553)
chr2 (358-433)||(24202148-24202224)
chr2 (362-406)||(24581484-24581528)
chr2 (358-477)||(34034349-34034467)
chr2 (356-440)||(40688625-40688709)
chr2 (394-466)||(43870988-43871059)
chr2 (361-440)||(15939294-15939373)
chr2 (365-440)||(17777149-17777223)
chr2 (358-436)||(20435779-20435858)
chr2 (358-440)||(23984209-23984292)
chr2 (383-434)||(37512368-37512419)
chr2 (357-440)||(40864400-40864483)
chr2 (385-440)||(44558031-44558086)
chr2 (365-439)||(1500970-1501044)
chr2 (358-440)||(2145721-2145803)
chr2 (358-440)||(3301813-3301895)
chr2 (358-440)||(9330487-9330569)
chr2 (358-440)||(11949982-11950064)
chr2 (358-440)||(17487706-17487788)
chr2 (394-436)||(18255656-18255698)
chr2 (358-440)||(19684075-19684156)
chr2 (358-440)||(27497514-27497596)
chr2 (358-440)||(33262444-33262526)
chr2 (362-440)||(34355727-34355805)
chr2 (358-440)||(39408676-39408758)
chr2 (358-440)||(44822425-44822507)
chr2 (394-455)||(9796932-9796993)
chr2 (359-436)||(10058871-10058948)
chr2 (394-455)||(10262774-10262835)
chr2 (423-476)||(12846775-12846828)
chr2 (358-427)||(15485664-15485733)
chr2 (358-479)||(15625261-15625385)
chr2 (394-455)||(17239936-17239997)
chr2 (358-403)||(18694787-18694832)
chr2 (359-440)||(23919463-23919544)
chr2 (382-451)||(26336706-26336775)
chr2 (358-439)||(27297177-27297258)
chr2 (359-440)||(28153128-28153209)
chr2 (394-455)||(33001552-33001613)
chr2 (394-447)||(36386121-36386173)
chr2 (359-440)||(37352479-37352560)
[»] chr1 (158 HSPs)
chr1 (358-440)||(21265658-21265740)
chr1 (358-440)||(33207207-33207289)
chr1 (358-440)||(22563388-22563470)
chr1 (358-440)||(36666562-36666644)
chr1 (358-440)||(42490396-42490478)
chr1 (358-440)||(47469059-47469141)
chr1 (362-479)||(4069586-4069702)
chr1 (358-439)||(24874973-24875054)
chr1 (360-440)||(5190767-5190847)
chr1 (359-466)||(13870070-13870177)
chr1 (356-451)||(27178683-27178778)
chr1 (358-440)||(1570178-1570260)
chr1 (358-440)||(6438050-6438132)
chr1 (358-440)||(6893223-6893305)
chr1 (358-440)||(7166213-7166295)
chr1 (358-440)||(15819587-15819669)
chr1 (358-440)||(16343030-16343112)
chr1 (366-479)||(17350067-17350180)
chr1 (358-440)||(18551619-18551701)
chr1 (387-477)||(32635168-32635258)
chr1 (358-440)||(34058216-34058298)
chr1 (356-434)||(37662549-37662627)
chr1 (358-459)||(39238714-39238815)
chr1 (358-479)||(40678821-40678942)
chr1 (358-440)||(42549995-42550077)
chr1 (358-440)||(44732635-44732717)
chr1 (358-479)||(47763361-47763482)
chr1 (358-440)||(50899496-50899578)
chr1 (358-439)||(46965742-46965823)
chr1 (382-446)||(42946475-42946539)
chr1 (358-479)||(52426859-52426981)
chr1 (353-479)||(21884569-21884694)
chr1 (358-479)||(29491468-29491588)
chr1 (387-486)||(32660858-32660957)
chr1 (358-440)||(2277756-2277838)
chr1 (358-440)||(2754362-2754444)
chr1 (358-440)||(7180600-7180682)
chr1 (382-440)||(8780794-8780852)
chr1 (358-440)||(8984492-8984573)
chr1 (358-440)||(11215003-11215085)
chr1 (358-440)||(11333666-11333748)
chr1 (358-440)||(11491687-11491769)
chr1 (359-479)||(13538391-13538513)
chr1 (358-440)||(19011357-19011439)
chr1 (358-440)||(19564139-19564220)
chr1 (358-479)||(25819183-25819304)
chr1 (358-440)||(25999852-25999934)
chr1 (358-440)||(32594253-32594335)
chr1 (358-440)||(33254730-33254812)
chr1 (358-440)||(33274902-33274984)
chr1 (358-440)||(45333698-45333779)
chr1 (358-440)||(48638534-48638616)
chr1 (394-455)||(4354104-4354165)
chr1 (359-440)||(23991250-23991331)
chr1 (394-455)||(39433393-39433454)
chr1 (393-478)||(50859344-50859428)
chr1 (358-437)||(2052699-2052779)
chr1 (360-440)||(6463022-6463102)
chr1 (390-446)||(10052451-10052507)
chr1 (364-440)||(19063319-19063395)
chr1 (394-466)||(19976541-19976612)
chr1 (360-440)||(31124624-31124704)
chr1 (359-439)||(34562774-34562854)
chr1 (366-434)||(47930663-47930731)
chr1 (365-451)||(10632703-10632790)
chr1 (358-440)||(40519529-40519612)
chr1 (358-440)||(4482584-4482666)
chr1 (358-440)||(4553532-4553614)
chr1 (358-440)||(7191034-7191116)
chr1 (353-443)||(7573678-7573768)
chr1 (358-440)||(8865856-8865938)
chr1 (358-440)||(9866170-9866252)
chr1 (358-440)||(11860044-11860126)
chr1 (358-440)||(13773170-13773252)
chr1 (358-440)||(16526163-16526245)
chr1 (358-440)||(16997245-16997327)
chr1 (358-440)||(18467184-18467266)
chr1 (358-440)||(18534003-18534085)
chr1 (356-434)||(18607801-18607879)
chr1 (358-440)||(35605609-35605691)
chr1 (358-440)||(42054335-42054417)
chr1 (358-440)||(43021608-43021690)
chr1 (358-440)||(43884796-43884878)
chr1 (358-419)||(3269621-3269682)
chr1 (394-455)||(11405491-11405552)
chr1 (382-443)||(19424069-19424130)
chr1 (383-440)||(21401419-21401476)
chr1 (360-436)||(24134642-24134719)
chr1 (358-427)||(26550496-26550565)
chr1 (370-451)||(26909845-26909926)
chr1 (383-440)||(30734436-30734493)
chr1 (386-451)||(35068717-35068782)
chr1 (366-451)||(36313954-36314039)
chr1 (394-455)||(49251394-49251455)
chr1 (394-443)||(50199487-50199536)
chr1 (358-434)||(1151761-1151837)
chr1 (358-434)||(6702578-6702654)
chr1 (358-477)||(9527424-9527543)
chr1 (356-440)||(10851824-10851908)
chr1 (358-434)||(12374506-12374581)
chr1 (358-434)||(26584738-26584814)
chr1 (358-434)||(34750382-34750457)
chr1 (394-487)||(43020646-43020740)
chr1 (359-431)||(49503145-49503217)
chr1 (359-434)||(6213424-6213499)
chr1 (357-440)||(6712095-6712178)
chr1 (358-456)||(38021250-38021348)
chr1 (385-440)||(45416164-45416219)
chr1 (365-440)||(50536973-50537048)
chr1 (360-403)||(51933510-51933553)
chr1 (353-459)||(52833102-52833208)
chr1 (358-440)||(2352551-2352633)
chr1 (354-432)||(2997651-2997729)
chr1 (358-440)||(6130019-6130101)
chr1 (358-440)||(8741475-8741557)
chr1 (358-440)||(10664781-10664862)
chr1 (358-440)||(12404358-12404439)
chr1 (394-436)||(15368840-15368882)
chr1 (358-408)||(15775741-15775791)
chr1 (358-440)||(17671396-17671478)
chr1 (394-440)||(18512561-18512607)
chr1 (360-434)||(19246649-19246722)
chr1 (357-439)||(19275935-19276017)
chr1 (374-440)||(23233969-23234035)
chr1 (358-440)||(25036248-25036330)
chr1 (358-440)||(25041460-25041542)
chr1 (360-418)||(27818573-27818631)
chr1 (382-440)||(28564331-28564389)
chr1 (397-443)||(29332322-29332368)
chr1 (358-432)||(31401239-31401313)
chr1 (359-433)||(31761989-31762063)
chr1 (358-440)||(34656381-34656463)
chr1 (359-429)||(35121046-35121116)
chr1 (382-440)||(36860624-36860682)
chr1 (358-440)||(40375301-40375383)
chr1 (394-436)||(41182809-41182851)
chr1 (358-455)||(42831946-42832043)
chr1 (358-440)||(45517254-45517336)
chr1 (357-419)||(52369598-52369660)
chr1 (394-447)||(1721175-1721228)
chr1 (362-419)||(2556562-2556619)
chr1 (394-447)||(2643822-2643875)
chr1 (410-447)||(3046176-3046213)
chr1 (394-443)||(3341747-3341796)
chr1 (359-440)||(3694902-3694982)
chr1 (391-479)||(9163315-9163403)
chr1 (391-455)||(9166562-9166627)
chr1 (394-443)||(9768820-9768869)
chr1 (394-455)||(15774311-15774372)
chr1 (394-455)||(19793561-19793622)
chr1 (382-431)||(23369049-23369098)
chr1 (394-455)||(23463985-23464046)
chr1 (359-440)||(27233990-27234071)
chr1 (410-455)||(34560337-34560382)
chr1 (360-436)||(34702331-34702408)
chr1 (394-455)||(37733790-37733851)
chr1 (394-455)||(39434653-39434714)
chr1 (358-439)||(48897104-48897185)
[»] scaffold1787 (1 HSPs)
scaffold1787 (358-434)||(402-478)
[»] scaffold0121 (2 HSPs)
scaffold0121 (356-440)||(11994-12078)
scaffold0121 (358-433)||(46528-46603)
[»] scaffold0246 (1 HSPs)
scaffold0246 (368-451)||(24392-24475)
[»] scaffold0366 (1 HSPs)
scaffold0366 (358-440)||(846-928)
[»] scaffold0024 (1 HSPs)
scaffold0024 (358-440)||(59785-59867)
[»] scaffold0809 (1 HSPs)
scaffold0809 (358-486)||(4775-4902)
[»] scaffold0063 (1 HSPs)
scaffold0063 (358-419)||(56325-56386)
[»] scaffold1372 (1 HSPs)
scaffold1372 (363-434)||(1871-1942)
[»] scaffold0707 (1 HSPs)
scaffold0707 (358-440)||(6-88)
[»] scaffold0519 (1 HSPs)
scaffold0519 (360-434)||(2954-3028)
[»] scaffold0128 (1 HSPs)
scaffold0128 (358-440)||(17622-17704)
[»] scaffold0028 (1 HSPs)
scaffold0028 (358-440)||(112110-112192)
[»] scaffold0010 (1 HSPs)
scaffold0010 (358-451)||(236332-236423)
[»] scaffold0009 (2 HSPs)
scaffold0009 (358-451)||(41628-41715)
scaffold0009 (358-413)||(266710-266765)
[»] scaffold0002 (1 HSPs)
scaffold0002 (358-440)||(8811-8893)
[»] scaffold0308 (1 HSPs)
scaffold0308 (394-466)||(7111-7182)
[»] scaffold0085 (1 HSPs)
scaffold0085 (356-440)||(27916-28000)
[»] scaffold0187 (2 HSPs)
scaffold0187 (365-440)||(11106-11181)
scaffold0187 (365-440)||(21434-21509)
[»] scaffold0608 (1 HSPs)
scaffold0608 (358-440)||(8968-9050)
[»] scaffold0445 (1 HSPs)
scaffold0445 (358-440)||(4000-4082)
[»] scaffold0250 (1 HSPs)
scaffold0250 (358-440)||(15007-15089)
[»] scaffold0117 (1 HSPs)
scaffold0117 (382-440)||(18465-18523)
[»] scaffold0038 (2 HSPs)
scaffold0038 (356-440)||(37399-37484)
scaffold0038 (358-439)||(23363-23443)
[»] scaffold0157 (1 HSPs)
scaffold0157 (356-440)||(15764-15848)
[»] scaffold1709 (1 HSPs)
scaffold1709 (360-419)||(175-234)
[»] scaffold1331 (1 HSPs)
scaffold1331 (360-419)||(87-146)
[»] scaffold0036 (1 HSPs)
scaffold0036 (358-436)||(25024-25103)
[»] scaffold0690 (1 HSPs)
scaffold0690 (358-440)||(3668-3750)
[»] scaffold0460 (1 HSPs)
scaffold0460 (363-429)||(13200-13266)
[»] scaffold0154 (1 HSPs)
scaffold0154 (362-440)||(28807-28885)
[»] scaffold0276 (1 HSPs)
scaffold0276 (359-440)||(1263-1344)
[»] scaffold0219 (1 HSPs)
scaffold0219 (394-443)||(6644-6693)
[»] scaffold0126 (1 HSPs)
scaffold0126 (394-447)||(22857-22909)
[»] scaffold0070 (1 HSPs)
scaffold0070 (359-459)||(12564-12664)
[»] scaffold0062 (1 HSPs)
scaffold0062 (360-476)||(3224-3341)
[»] scaffold0049 (1 HSPs)
scaffold0049 (430-475)||(55234-55279)
[»] scaffold0043 (1 HSPs)
scaffold0043 (385-434)||(66580-66629)
[»] scaffold0001 (1 HSPs)
scaffold0001 (360-436)||(419712-419789)


Alignment Details
Target: chr8 (Bit Score: 336; Significance: 0; HSPs: 153)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 352 - 722
Target Start/End: Complemental strand, 10557571 - 10557200
Alignment:
352 cagtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||    
10557571 cagtcttgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaagttg 10557472  T
452 aatttctatccactatactacttgaccacagaaaa-gtaaacacttgcatatgactgtaaatgttatagtactaatactaaccataaagactttagctcc 550  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||    
10557471 aatttctagccactatactacttgaccacagaaaaagtaaacacttgcataggactgtaaatgttatagtactaatgctaaccataaagactttagctcc 10557372  T
551 agagttaagagcattgatgatcatctttctctcaacagggccagtaatctcaactttcctatcagaaacagctggtggaacaggtgcacagatccaatct 650  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10557371 agagttaagagcattgatgatcatctttctctcaacagggccagtaatctcaactttcctatcagaaacagctggtggaacaggtgcacagatccaatct 10557272  T
651 ccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctctgcttct 722  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
10557271 ccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttct 10557200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 10557903 - 10557636
Alignment:
20 cttgagaacgccgaaaagttgagtgattgtggtagaagtagagaccaaaatcaacaagacaaccggttgcaggttcaccatcaatcagaatatgagcttc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10557903 cttgagaacgccgaaaagttgagtgattgtggtagaagtagagaccaaaatcaacaagacaaccggttgcaggttcaccatcaatcagaatatgagcttc 10557804  T
120 cggtaaatgccaacctcttggtcgcacaaaaagctttgctatctcatcattcagcttgtaaactttgtttctacctttgtcatggaatgttatggtccca 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10557803 cggtaaatgccaacctcttggtcgcacaaaaagctttgctatctcatcattcagcttgtaaactttgtttctacctttgtcatggaatgttatggtccca 10557704  T
220 gccacagcatccttcaagttcacttgacctttcataagattctcccagcttggagaaagtgcatcctc 287  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10557703 gccacagcatccttcaagttcacttgacctttcataagattctcccagcttggagaaagtgcatcctc 10557636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 8402404 - 8402283
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc 457  Q
    |||||||||||||||||||| || || |||||||||||||||||| ||||| |||| | ||| || |  |||||||||| |||||||| | |||||||||    
8402404 cgtgagcttagctcaattggtagggacattgcataatatatgcagcggccggggttcgtaccccgaattccccacttattcaccttaagaggtgaatttc 8402305  T
458 tatccactatactacttgacca 479  Q
    || ||||||  |||||||||||    
8402304 tagccactaggctacttgacca 8402283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 360 - 479
Target Start/End: Original strand, 39164982 - 39165100
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta 459  Q
    ||||||||||||| |||| || || ||||||||| ||||||| |||||| |||| ||||  |||||||||||||||| |||||||| | |||||||||||    
39164982 tgagcttagctcagttggtagagacattgcataacatatgcaagggccg-ggttcgaacaccggacaccccacttattcaccttaagaggtgaatttcta 39165080  T
460 tccactatactacttgacca 479  Q
     ||||||  |||||||||||    
39165081 gccactaggctacttgacca 39165100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 1588802 - 1588886
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| |||| |||||||||||||||||||||| ||| |||||| ||||||||||| ||||||| |||| ||||||    
1588802 tatatgcaggggccggggttcgaacctcggacaccccacttattcactttaaaa-gtgaatttctagccactatgctacctgacca 1588886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 387 - 466
Target Start/End: Complemental strand, 43508515 - 43508437
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||| |||||||| |||||||||| |||||||||||||||| |||||| ||| ||||||||||| ||||||    
43508515 tgcataatatatgtaggggccggggtttgaaccccggacaccccacttattcacctt-aaaggtgaatttctagccacta 43508437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 481013 - 481095
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |||||    
481013 cgtgagcttagctcagttggtagggacattgcataatttatgcaggggccgcggttcgaaccccggacaccccacttctccac 481095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 2800017 - 2800138
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
2800017 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 2800115  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
2800116 ctagccactaggctacctgacca 2800138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 34894375 - 34894453
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
34894375 agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 34894453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42877036 - 42877117
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || || |||||||||| |||||||||||||||||| ||||| || ||||||||||| |||||    
42877036 cgtgagcttagctcaattggtagggacattgcataatttatgcaggggccgtggttcgaacc-cgaacaccccacttctccac 42877117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 10292350 - 10292469
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||| | | || |||||||||||||||||||||| ||| |||||| ||||||||    
10292350 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccacttattcactttaaaa-gtgaattt 10292448  T
457 ctatccactatactacttgac 477  Q
    ||| |||||| ||||| ||||    
10292449 ctagccactagactacctgac 10292469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 23178959 - 23178883
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| ||||||    
23178959 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt 23178883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 355 - 451
Target Start/End: Original strand, 41458294 - 41458390
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||| |||| |||| || ||||||||||| ||||||||||||| | | || ||||||||||||| |||||| ||||| || |||||||    
41458294 tctcgtgagcttaactcagttggtagggatattgcatattatatgcaggggctgggtttcgaacctcggacactccacttctccacatttaaatgtg 41458390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 7764004 - 7763925
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| || ||||||||||| ||||||||||||||| | |||||||  |||||||||||||| |||||    
7764004 gagcttagctcagttggtagagatattgcatattatatgcaggggccgggatttgaactccggacaccccacttctccac 7763925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 356 - 439
Target Start/End: Complemental strand, 10200751 - 10200668
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||    
10200751 ctcgtgagcttagctcagttggtagagatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcca 10200668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 2787149 - 2787067
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
2787149 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 2787067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2792781 - 2792863
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
2792781 cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccac 2792863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 5328631 - 5328553
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||| ||||| |||||    
5328631 agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccac 5328553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10736942 - 10736860
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
10736942 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 10736860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 14876670 - 14876588
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||| |||||||||| |||| |||| ||||||||||||| |||||| |||||    
14876670 cgtgagcttagctcagttggtagggaaattgcatattatatgcaggagccggggttcgaacctcggacactccacttctccac 14876588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 26022249 - 26022331
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| | ||||| |||||| |||||    
26022249 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccac 26022331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 357 - 451
Target Start/End: Complemental strand, 26192785 - 26192691
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||| ||| |||| || ||||||||||| ||||||||| || || |||| ||||| |||||||||||||| ||||  ||||||||||    
26192785 tcgtgagcttagttcagttggtagggatattgcatattatatgcagaggtcggggttcgaaccccggacaccccacttctccatattaaaatgtg 26192691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29716862 - 29716944
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
29716862 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 29716944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34413064 - 34413146
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
34413064 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 34413146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 10083165 - 10083246
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| ||||    
10083165 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctcca 10083246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 27077164 - 27077083
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||| | |||||||||||||| |||||    
27077164 gtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccggacaccccacttctccac 27077083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 40362050 - 40362131
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| || | || ||||||||||| |||||||||||| || |||| ||||||||||||| |||||| ||||    
40362050 cgtgagcttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacctcggacactccacttctcca 40362131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 12770372 - 12770452
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||  || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |||||    
12770372 tgagcttagctcagttgatagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac 12770452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 22274677 - 22274597
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||||||||| |||||    
22274677 tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccccacttctccac 22274597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 35939489 - 35939565
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| ||||  ||||  |||||||||||||    
35939489 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcaaaccgtggacaccccactt 35939565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 15042425 - 15042343
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||| ||||| ||||||  |||||||||    
15042425 tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaa-ttctaaccactacgctacttgac 15042343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 33570489 - 33570407
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    |||||||| ||| || |||| |||||||||||||||||||||| ||||||| || ||||| ||||| |||||| ||||||||||    
33570489 tatatgcatgggtcggggttcgaacctcggacaccccacttattcaccttataaggtgaa-ttctagccactaaactacttgac 33570407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 94579 - 94497
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| ||||  ||| ||||| ||||||| |||||| |||||    
94579 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggacactccacttctccac 94497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6280482 - 6280564
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
6280482 cgtgagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccac 6280564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6659291 - 6659373
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
6659291 cgtgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 6659373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6739693 - 6739775
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
6739693 cgtgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 6739775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 7816409 - 7816487
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||||||||||| |||||| |||||    
7816409 agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaacctcggacactccacttctccac 7816487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 8034480 - 8034398
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||  | |||||||||||| |||||    
8034480 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaacaccagacaccccacttctccac 8034398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8265270 - 8265352
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| |  |||| ||||| ||||||| |||||| |||||    
8265270 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaaccccggacactccacttctccac 8265352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10568087 - 10568169
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| || |||||||||  | |||||||||| |||||||||||||| |||||    
10568087 cgtgagtttagctcagttggtagggatattgcatattaaatgcaggggaaggggtttgaaccccggacaccccacttctccac 10568169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 11231424 - 11231498
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||| |||  || || |||||||||| ||||||||||||| |||| ||||| ||||||||||||||    
11231424 tgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt 11231498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11875888 - 11875970
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
11875888 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac 11875970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11890895 - 11890977
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
11890895 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac 11890977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17027948 - 17027867
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||| || |||| |||| ||||| |||||||||||||| |||||    
17027948 cgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaacc-cggacaccccacttctccac 17027867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17072631 - 17072549
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| || |||| ||  |||||||||| ||||||||||||||| |||| ||||| || ||||||||||| |||||    
17072631 cgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccac 17072549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17558384 - 17558303
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||| || |||| |||| ||||| |||||||||||||| |||||    
17558384 cgtgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaacc-cggacaccccacttctccac 17558303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17575640 - 17575722
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| || |||| ||  |||||||||| ||||||||||||||| |||| ||||| || ||||||||||| |||||    
17575640 cgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccacttctccac 17575722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17698524 - 17698606
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| |||||    
17698524 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac 17698606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 28909467 - 28909549
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| || ||||||| |||| |||| ||||| ||||||| |||||| |||||    
28909467 cgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaaccccggacactccacttctccac 28909549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31712551 - 31712633
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| ||||||| ||||||| ||| |||||| |||||||  |||| ||||| |||||||||||||| |||||    
31712551 cgtgagtttagctcacttggcagggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccac 31712633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 37717365 - 37717447
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
37717365 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 37717447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43656038 - 43656120
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||||| || |||| ||||||||||||  |||||| |||||    
43656038 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggtcggggttcgaacctcggacattccacttctccac 43656120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43856450 - 43856368
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
43856450 cgtgagcttaactcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac 43856368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 458
Target Start/End: Original strand, 2696531 - 2696631
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| || |||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
2696531 cgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 2696629  T
457 ct 458  Q
    ||    
2696630 ct 2696631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 4798601 - 4798517
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||  || ||||| ||||| |||||| ||||| ||||||    
4798601 tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgtaaggtgaa-ttctagccactagactacctgacca 4798517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 16432196 - 16432115
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||| |||| |||||||| |||||| ||||    
16432196 cgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacatcggacactccacttctcca 16432115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 25890471 - 25890390
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| | |||| || || |||||||||| |||||| |||||| |||| ||||| |||||||||||||| |||||    
25890471 gtgagcttagcttagttggtagggacattgcataatttatgcaagggccggggttcgaaccccggacaccccacttctccac 25890390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 387 - 451
Target Start/End: Complemental strand, 2908130 - 2908066
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||||||||||||| |||| |||||  ||||||||||||| ||| | ||||||||||    
2908130 tgcataatatatgcaggggccggggttcgaaccctggacaccccacttctccgcattaaaatgtg 2908066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 7194266 - 7194346
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| ||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
7194266 tgagcttagttcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 7194346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 28420494 - 28420410
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| |||| ||  |||||||||| ||||||| || |||| |||| ||||| ||||||| |||||| |||||    
28420494 ctcgtgagcttagctcagttggtaggaatattgcatattatatgctggagccggggttcgaaccccggacactccacttctccac 28420410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 364 - 440
Target Start/End: Original strand, 40393326 - 40393402
Alignment:
364 cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||  |||||||||||| |||||||||| || |||| ||||| || ||||||| ||| |||||    
40393326 cttagctcaattggcaggaatattgcataatttatgcaggggtcggggttcgaaccccgaacacccctcttctccac 40393402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 359 - 419
Target Start/End: Original strand, 42006781 - 42006841
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    |||||||||||||| |||| || ||||||||||| |||||||||| ||||||||| |||||    
42006781 gtgagcttagctcagttggtagggatattgcatattatatgcaggagccgtggttcgaacc 42006841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 13647518 - 13647443
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| |||||||||| | ||||||| ||||| ||||||| |||||| |||||    
13647518 ttagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccac 13647443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 13747943 - 13747868
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| |||||||||| | ||||||| ||||| ||||||| |||||| |||||    
13747943 ttagctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccacttctccac 13747868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 15856575 - 15856492
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| |||| || || |||||||||| ||| ||||| ||| ||||  ||||||||||||||||||| |||||    
15856575 tcgtgagcttaactcagttggtagggacattgcataatttatacagggaccggggttcaaacctcggacaccccacttctccac 15856492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Original strand, 23239159 - 23239241
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    |||||| ||||| || |||||||||| |||||||||||||||| ||||||| || |||||||| || |||||| ||||| ||||    
23239159 tatatgtaggggtcggggtttgaaccccggacaccccacttattcaccttataaagtgaattt-taaccactagactacctgac 23239241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 24480886 - 24480807
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||| |||| || ||||||| ||| ||||||||||||| | |||| |||||| ||||||||||||| |||||    
24480886 gagcttatctcagttggtagagatattgtatattatatgcaggggctggggttcgaaccttggacaccccacttctccac 24480807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 34266017 - 34266096
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| || ||||||||||| |||||||||| |  | |||| ||||||||||||| |||||| |||||    
34266017 gagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaacctcggacactccacttctccac 34266096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 37708692 - 37708775
Alignment:
358 cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||  |||||  ||||||||||||||| |||| ||||| |||||| ||||||| |||||    
37708692 cgtgagcttagctcaattggtagggataagtgcattttatatgcaggggccggggttcgaaccccggacatcccacttctccac 37708775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 458
Target Start/End: Complemental strand, 41454922 - 41454824
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttct 458  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||||||||||| || |||  |||||||||||||    
41454922 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctt-taatgtgaatttct 41454824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 369 - 440
Target Start/End: Original strand, 44444557 - 44444628
Alignment:
369 ctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||| |||| || ||||||||||| ||||||||||||| | |||| ||||| |||||||||||||| |||||    
44444557 ctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacaccccacttctccac 44444628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 257541 - 257623
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| ||||||  |||||| |||||    
257541 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccac 257623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 658379 - 658297
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| ||||||  |||||| |||||    
658379 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccac 658297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 844115 - 844033
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| ||||||  |||||| |||||    
844115 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccgaggttcgaaccccggacattccacttctccac 844033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 1503914 - 1503987
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||| ||||||| ||||||| ||| |||||||||| |||| |||| ||||| | ||||||||||||    
1503914 tgagcttagctcagttggcagggatattg-atattatatgcaggagccggggttcgaaccccagacaccccactt 1503987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 5570896 - 5570978
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||  | ||||||||||  |||||||||||| ||  ||| ||||| |||||||||||||| |||||    
5570896 cgtgagcttagctcagttggttgggatattgcatgttatatgcaggggtcggagttcgaaccccggacaccccacttctccac 5570978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 447
Target Start/End: Original strand, 7314731 - 7314821
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||| || |||||||||||| || | | ||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| ||||||    
7314731 cgtgagcataactcaattggcagggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaa 7314821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 7797136 - 7797214
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
7797136 agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccacttctccac 7797214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 13059245 - 13059163
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || | |||||||| ||||||||||| | |||| ||||| | |||||||||||| |||||    
13059245 cgtgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccac 13059163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 16449127 - 16449209
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||  | |||| ||||| | ||||| |||||| |||||    
16449127 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccagacactccacttctccac 16449209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 22717795 - 22717869
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||| |||  ||  | |||||||||| ||||||||||||| |||| ||||| ||||||||||||||    
22717795 tgagcttagctcagttgaaaggaacattgcataatttatgcaggggccgaggttcgaaccccggacaccccactt 22717869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 23858199 - 23858249
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg 408  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||||    
23858199 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccg 23858249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 424
Target Start/End: Original strand, 24458319 - 24458385
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcgga 424  Q
    ||||||||||||||| |||| || ||||||| ||| ||||||||||||||| |||| ||||| ||||    
24458319 cgtgagcttagctcagttggaagggatattgtatattatatgcaggggccggggttcgaaccccgga 24458385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 364 - 434
Target Start/End: Complemental strand, 25812271 - 25812201
Alignment:
364 cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||||| || |||||||||| |||| |||| ||| |||| ||||| | ||||||||||||    
25812271 cttagctcaattggcagggacattgcataatttatggagggtccggggttcgaaccccagacaccccactt 25812201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31451025 - 31450943
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||  ||||||| |||||| |||||    
31451025 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccac 31450943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36035247 - 36035165
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| ||    | |||||  |||||||||||| || |||| |||||||||||||||||||| |||||    
36035247 cgtgagcttagctcaattggtagaataaatgcattttatatgcaggggtcggggttcgaacctcggacaccccacttctccac 36035165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 37290948 - 37291006
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||||||||  ||| ||||| |||||||||||||| |||||    
37290948 gatattgcatattatatgcaggggccggcgttcgaaccccggacaccccacttctccac 37291006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 38219636 - 38219554
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
38219636 cgtgagcatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 38219554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42880950 - 42881032
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||| ||| |||| |||| ||||| ||||||| |||||| |||||    
42880950 cgtgagcttaactcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacactccacttctccac 42881032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43085291 - 43085209
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||  |||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
43085291 cgtgagcttagctcagttgggagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccac 43085209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43284034 - 43283952
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||| || |||||    
43284034 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccac 43283952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 472
Target Start/End: Complemental strand, 44070428 - 44070351
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac 472  Q
    |||||| |||||||| |||| ||||||||||||||| |||||| ||||||| || ||||| ||||| |||||| |||||    
44070428 tatatgtaggggccgcggttcgaacctcggacaccctacttattcaccttataaggtgaa-ttctagccactaaactac 44070351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 5326238 - 5326157
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||| |||||  ||| ||||| ||||||| |||||| ||||    
5326238 cgtgagcttagctcagttggtagagatattgcattttatatgcagaggccggtgttcgaaccccggacactccacttctcca 5326157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 7453354 - 7453435
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||| ||||||||  ||| || ||||||||||  |||||| |||||||| |||| ||||| |||||||||||||| ||||    
7453354 cgtgagtttagctcagctggtagggatattgcattttatatgtaggggccggggttcgaaccccggacaccccacttctcca 7453435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 8969098 - 8969179
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| | |||| ||  |||||||||| |||||||||| || | |||| ||||||||||||| |||||| |||||    
8969098 gtgagcttagctaagttggtaggaatattgcatattatatgcaggagctggggttcgaacctcggacactccacttctccac 8969179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 13105122 - 13105175
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||||| |||| ||||||| |||||||||||| |||||    
13105122 tgcataatatatgcaagggccggggttcgaacctcagacaccccacttctccac 13105175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 382 - 443
Target Start/End: Complemental strand, 19957393 - 19957332
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| ||||||    
19957393 gataatgcatattatatgcaggggacgaggttcgaaccccggacaccccacttattcacctt 19957332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 23435300 - 23435219
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||  || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| |||||    
23435300 gtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccac 23435219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 355 - 440
Target Start/End: Original strand, 38344048 - 38344133
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| |||| || ||||||||||| |||||||||| || | |||| ||||| | ||||| |||||| |||||    
38344048 tctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccagacactccacttctccac 38344133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 427
Target Start/End: Complemental strand, 38955262 - 38955193
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    |||||||||| |||| |||| || |||||| |||| ||||||||||||||| |||| ||||| |||||||    
38955262 cgtgagcttaactcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacac 38955193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 447
Target Start/End: Original strand, 39362267 - 39362356
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||| ||  |  ||| ||||| | |||||||||||| ||||| ||||||    
39362267 cgtgagcttagctcagttggtagggatattgcatattatatgcagaggttggagttcgaaccccagacaccccacttctccacattaaaa 39362356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 41616434 - 41616341
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||| || |||| |||| || ||||||| ||| ||||||||||||||| |||| ||||| |||| || |||||| ||||| ||| ||||||    
41616434 cgtgagcataactcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccggatactccacttctccacattataatgtg 41616341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 407
Target Start/End: Original strand, 41689884 - 41689933
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggcc 407  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||    
41689884 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggcc 41689933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 1937312 - 1937388
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| ||||||    
1937312 cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt 1937388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 4615744 - 4615668
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||| |||| ||| |||| || ||||||||||| |||||||||| ||   |||||||||||||||||| ||||||    
4615744 cgtgagtttagttcagttggtagggatattgcatattatatgcaggagcttgggtttgaacctcggacactccactt 4615668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 392 - 436
Target Start/End: Original strand, 8350469 - 8350513
Alignment:
392 aatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    |||||||||||||||||  ||| ||||||||||||||||||||||    
8350469 aatatatgcaggggccggagttcgaacctcggacaccccacttat 8350513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 8698648 - 8698572
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||| |||||  | |||| ||| | ||||||||||||||    
8698648 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccggacaccccactt 8698572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 396 - 444
Target Start/End: Original strand, 11822999 - 11823047
Alignment:
396 tatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    |||| |||||||| |||||||||| |||||||||||||||| |||||||    
11822999 tatgtaggggccggggtttgaaccccggacaccccacttattcacctta 11823047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 357 - 405
Target Start/End: Complemental strand, 22437859 - 22437811
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcagggg 405  Q
    |||||||||||||||| |||| || ||||||||||||| ||||||||||    
22437859 tcgtgagcttagctcagttggtagggatattgcataatttatgcagggg 22437811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 23339964 - 23339888
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||| |||| |||| || ||||||| ||| |||||| |||||||| |||| |||||  |||||||||||||    
23339964 cgtgagcttaactcagttggtagagatattgtatattatatgtaggggccggggttcgaaccctggacaccccactt 23339888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 439
Target Start/End: Original strand, 30300332 - 30300412
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||||||| |||| || ||   |||||||||||||||||||||| |||| ||||| |||| |||| |||| ||||    
30300332 gtgagcttagctcagttggaagagacgatgcataatatatgcaggggccggggttcgaaccccggaaaccctacttctcca 30300412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 366 - 477
Target Start/End: Complemental strand, 35301252 - 35301141
Alignment:
366 tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac 464  Q
    ||||||| ||||||| || | ||||| || ||||||||||| || |||| ||||  ||||||||| |||||| ||| |||||| ||||||||||| ||||    
35301252 tagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttattcactttaaaa-gtgaatttctagccac 35301154  T
465 tatactacttgac 477  Q
    || ||||| ||||    
35301153 tagactacctgac 35301141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Complemental strand, 12293 - 12246
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg 405  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||    
12293 cgtgagcttagctcagttggtagggatattgcatattatatgcagggg 12246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 363 - 434
Target Start/End: Complemental strand, 7109353 - 7109283
Alignment:
363 gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||| |||| || ||||||||||| ||||||||||||||| || | ||||| || |||||||||||    
7109353 gcttagctcagttggtagagatattgcatattatatgcaggggccgaggctcgaacc-cgaacaccccactt 7109283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 446
Target Start/End: Original strand, 14583228 - 14583287
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa 446  Q
    |||||||||||||||||||| | |||| ||||| || ||||||||||| ||||| |||||    
14583228 tgcataatatatgcaggggctggggttcgaaccacgaacaccccacttctccacattaaa 14583287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 36359778 - 36359696
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    |||||||||||||||  ||| ||| | |||||||||||||||| ||||||| || ||||| ||||| |||||| ||||| ||||    
36359778 tatatgcaggggccggagttcgaatcccggacaccccacttattcaccttataaggtgaa-ttctagccactagactacctgac 36359696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 38745347 - 38745264
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcata-atatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||||||||  |||||||| |||||  |||| |||||  ||||||||||||| |||||    
38745347 cgtgagcttagctcagttggtagggatattgcatatttatatgcatgggccagggttcgaacccaggacaccccacttctccac 38745264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 1337159 - 1337101
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
1337159 gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 1337101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 5683760 - 5683838
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||| ||  |||||||||| ||||||||||||  | |||| ||||| | ||||||| |||| |||||    
5683760 agcttagctcaattggtaggaatattgcatattatatgcaggggttggggttcgaaccccagacaccctacttctccac 5683838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 6942575 - 6942517
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
6942575 gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 6942517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 9370194 - 9370252
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||||| |  |||| ||||| |||||||| |||||||||||    
9370194 gatattgcatattatatgcaggggtcagggttcgaaccccggacacctcacttatccac 9370252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10573103 - 10573185
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| ||||||||||||  | |||| ||||| || |||| |||||| |||||    
10573103 cgtgagtttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccgaacactccacttctccac 10573185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11872068 - 11872150
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| ||| | |||| || |||||| |||  ||||||||||||||| |||||||||| || |||| |||||| |||||    
11872068 cgtgagctttgcttagttggtagagatattacattttatatgcaggggccggggtttgaaccccgaacactccacttctccac 11872150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 13406602 - 13406684
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| ||||  ||| |||||  |||||| |||||| |||||    
13406602 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggagttcgaaccctggacactccacttctccac 13406684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 17980317 - 17980359
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| |||| ||||| ||||||||||||||||    
17980317 tatatgcaggggccggggttcgaaccccggacaccccacttat 17980359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 28378847 - 28378932
Alignment:
394 tatatgcaggggccgtggtttgaacctcggaca-ccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||| | |||| ||||| |||||| |||||||||| ||||||| || ||||| ||||| |||||| ||||| ||||||    
28378847 tatatgcaggggctgaggttcgaaccccggacacccccacttattcaccttataaggtgaa-ttctaaccactaaactacctgacca 28378932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29514628 - 29514710
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| |||||||||| || | ||||  |||| ||||||| |||||| |||||    
29514628 cgtgagcttagctcagttggtagggatattgtatattatatgcaggagctggggttcaaaccccggacactccacttctccac 29514710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 30972885 - 30972804
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||| || |||| |||| ||| | ||||||| |||||| |||||    
30972885 cgtgagcttagctcagttggtagggatattgcatattatatgccggagccg-ggttcgaatcccggacactccacttctccac 30972804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 31406787 - 31406841
Alignment:
386 ttgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| ||||||||||||| |||| |||||||||| ||| ||||| |||||    
31406787 ttgcataatttatgcaggggccggggttcgaacctcggataccacacttctccac 31406841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 466
Target Start/End: Complemental strand, 31802966 - 31802863
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttct 458  Q
    |||||| ||||||||||||||| ||| |||||    ||||| ||| |||| ||||  |||||||||  |||||||||| |||||||| | |||||||| |    
31802966 gtgagcatagctcaattggcagggatgttgca----atatgtaggagccggggttcaaacctcggattccccacttattcaccttaagaggtgaatttat 31802871  T
459 atccacta 466  Q
    | ||||||    
31802870 agccacta 31802863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 404
Target Start/End: Complemental strand, 32719675 - 32719629
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggg 404  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||    
32719675 cgtgagcttagctcagttggtagggatattgcatattatatgcaggg 32719629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34158725 - 34158643
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || | || |||||| |||||    
34158725 cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcatactccacttctccac 34158643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 34873124 - 34873170
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| || |||| |||||||||||||||||||| |||||    
34873124 tatatgcaggggtcggggttcgaacctcggacaccccacttctccac 34873170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 361 - 439
Target Start/End: Complemental strand, 37524272 - 37524194
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||||| |||| || ||||||||||| ||||||||| ||||| ||||  ||||||  |||| |||||| ||||    
37524272 gagcttagctcagttggtagagatattgcatattatatgcagaggccgaggttcaaacctcatacactccacttctcca 37524194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 38283126 - 38283208
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||| |||| ||||||| || |||  ||||| ||||||||||||| |||| ||||| | |||||||||||| |||||    
38283126 cgtgagtttaactcagttggcagggacattatataatttatgcaggggccggggttcgaaccccagacaccccacttctccac 38283208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 40740551 - 40740608
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||||||||||||| || | | |||||||||||||||||||| |||||    
40740551 gatattgcatattatatgcaggggc-gtaggtcgaacctcggacaccccacttctccac 40740608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43186855 - 43186937
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||  | || ||||| ||||||| |||||| |||||    
43186855 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccaggattcgaaccccggacactccacttctccac 43186937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 431
Target Start/End: Complemental strand, 2294167 - 2294094
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca 431  Q
    |||||| ||||||||||||  || |||||| |||| |||||||||||| || |||| ||||| | |||||||||    
2294167 cgtgagtttagctcaattgatagggatattacatattatatgcaggggtcggggttcgaaccccagacacccca 2294094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #139
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 3912207 - 3912150
Alignment:
383 atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||||||||| ||||| |||||||| |  ||||||||||||| |||||    
3912207 atattgcatattatatgcagaggccgaggtttgaatcctggacaccccacttctccac 3912150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 5184947 - 5184886
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||| | |||| |||||  ||||||||||||||| ||||||| || |||||||    
5184947 tatatgcaggggctggggttcgaaccctggacaccccacttattcaccttataaggtgaatt 5184886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 5332919 - 5333000
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||  ||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
5332919 gtgagcttagctcagttggtagagatattatatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 5333000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 8862193 - 8862112
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| | |||| || ||||||||||| |||||||||||| |  |||| ||||  ||||||| |||||| |||||    
8862193 gtgagcttagctaagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacactccacttttccac 8862112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 9524992 - 9525053
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| | ||||||| |||||| ||||||| || |||||||    
9524992 tatatgcaggggccggggttcgaaccccagacaccctacttattcaccttataaggtgaatt 9525053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 10030415 - 10030496
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||  | |||| |||||| |||||    
10030415 gtgagtttagctcagttggtagagatattgcatattatatgcaggtgccggggttcgaaccctgaacactccacttctccac 10030496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 10199802 - 10199741
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |  ||||||||||||| ||||||| || |||||||    
10199802 tatatgcaggggccggggttcgaaccccaaacaccccacttattcaccttataaggtgaatt 10199741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 13702412 - 13702351
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||||| |||||| ||||||| ||||||| || |||||||    
13702412 tatatgcaggggtcggggttcgaacctcagacacctcacttattcaccttataaggtgaatt 13702351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 14011098 - 14011045
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||||||||||  ||| |||||||||||| ||||||||| || |||||||    
14011098 tatatgcaggggccggagttcgaacctcggacatcccacttattcatcttaaaa 14011045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 17467313 - 17467361
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||    
17467313 tatatgcaggggccg-ggttcgaaccccggacaccccacttattcacctt 17467361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 17987509 - 17987448
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||  ||| ||||| ||||||||||| |||| ||||||| || |||||||    
17987509 tatatgcaggggccggagttcgaaccccggacaccccaattattcaccttataaggtgaatt 17987448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 24608543 - 24608482
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| | ||||||| |||||| ||||||| || |||||||    
24608543 tatatgcaggggccggggttcgaaccccagacaccctacttattcaccttataaggtgaatt 24608482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 30942659 - 30942598
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| || |||||||||||||  |||||| || |||||||    
30942659 tatatgcaggggccggggttcgaaccccgaacaccccacttatttaccttataaggtgaatt 30942598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 362 - 407
Target Start/End: Original strand, 37838583 - 37838628
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggcc 407  Q
    |||||||||||| ||| || ||||||||||| ||||||||||||||    
37838583 agcttagctcaaatggtagggatattgcatattatatgcaggggcc 37838628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 38620408 - 38620327
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||| ||| |||||||||| |||| | || ||||| || |||| |||||| |||||    
38620408 gtgagcttagctcagttggtagggatattgtatattatatgcaggagccgggattcgaaccccgaacactccacttctccac 38620327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 2e-23; HSPs: 167)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 36763431 - 36763553
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaatt 455  Q
    ||||||||| ||||| |||| || || ||||||||||||||||||||||||  ||||||||| |||||||||||||||| || |||  |||| |||||||    
36763431 cgtgagcttggctcagttggtagggacattgcataatatatgcaggggccggagtttgaacc-cggacaccccacttattcatctttaaaaaggtgaatt 36763529  T
456 tctatccactatactacttgacca 479  Q
    |||| |||||| ||||||||||||    
36763530 tctagccactagactacttgacca 36763553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 9624981 - 9625102
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
9624981 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 9625079  T
457 ctatccactatactacttgacca 479  Q
    ||| |||||| ||||| ||||||    
9625080 ctagccactagactacctgacca 9625102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24303392 - 24303474
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |||||    
24303392 cgtgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac 24303474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 361 - 451
Target Start/End: Original strand, 43280073 - 43280163
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||||||||||| || |||||||||| ||||||||||||| |||| ||| | |||||||||||||| ||||| || |||||||    
43280073 gagcttagctcaattggcagggacattgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccacatttaaatgtg 43280163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 17602746 - 17602662
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||||||||||| |||||    
17602746 ctcgtgagcttagctcagttggtagggatattgcatattatatgtaggggccgaggttcgaaccccggacaccccacttctccac 17602662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 360 - 451
Target Start/End: Complemental strand, 49443489 - 49443398
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||| |||||||||||||||| || |||||||||| |||||||||||||  ||| ||||| |||||||||||||| ||||| || |||||||    
49443489 tgagtttagctcaattggcagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccacatttaaatgtg 49443398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19222654 - 19222572
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| ||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |||||    
19222654 cgtgagcttaactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac 19222572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 27183778 - 27183657
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
27183778 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 27183680  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
27183679 ctagccactaggctacctgacca 27183657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 32256622 - 32256540
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||||| |||| ||||| |||||||||||||| |||||    
32256622 cgtgagcttagctcagttggtagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac 32256540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34102679 - 34102597
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
34102679 cgtgagcttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 34102597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 39719937 - 39720019
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
39719937 cgtgagtttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 39720019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 41936471 - 41936393
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
41936471 agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 41936393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 466
Target Start/End: Original strand, 24559387 - 24559495
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| || |||| |||| |||||||| ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
24559387 cgtgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 24559485  T
457 ctatccacta 466  Q
    ||| ||||||    
24559486 ctaaccacta 24559495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 46845039 - 46844946
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||||||||||||| || |||||||||| |||||||||| ||  ||| ||||| ||||||||| |||| ||||| || |||||||    
46845039 cgtgagcttagctcaattggcagggacattgcataatttatgcaggggtcggagttcgaaccccggacaccctacttctccacatttaaatgtg 46844946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 11436504 - 11436588
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||| |||| |||| || ||||||||||| |||||||||||||||||||| |||||  ||||||||||||| |||||    
11436504 ctcgtgaacttaactcagttggtagggatattgcatattatatgcaggggccgtggttcgaaccctggacaccccacttctccac 11436588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 30779637 - 30779553
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| |||||  ||||||||||||| |||||    
30779637 ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacaccccacttctccac 30779553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 477
Target Start/End: Complemental strand, 36331823 - 36331704
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||||||||||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| ||||| ||    
36331823 cgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaaagtgaa-tt 36331725  T
457 ctatccactatactacttgac 477  Q
    ||| |||||| ||||| ||||    
36331724 ctagccactagactacctgac 36331704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 53163596 - 53163672
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| ||||||||||||||    
53163596 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccactt 53163672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 15975155 - 15975230
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||||||||||| ||||||    
15975155 gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacctcggacactccactt 15975230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 360 - 479
Target Start/End: Original strand, 45118644 - 45118763
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta 459  Q
    ||||||||||||| |||| || || ||||||| |||||||||||||||| |||| |||||  |||  |||||||||| ||| |||| | |||||||||||    
45118644 tgagcttagctcagttggtagggacattgcattatatatgcaggggccggggttcgaacccgggattccccacttattcactttaagaggtgaatttcta 45118743  T
460 tccactatactacttgacca 479  Q
     ||||||  ||||| |||||    
45118744 gccactaggctactcgacca 45118763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4139002 - 4139084
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
4139002 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 4139084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25954862 - 25954780
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||||||||||||| |  ||||| ||||| ||||||||||||||| |||| ||||||||||||||||| || |||||    
25954862 cgtgaggttagctcaattggtatggatatcgcatattatatgcaggggccgaggttcgaacctcggacaccccatttctccac 25954780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 29373517 - 29373435
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| |  ||||||||||| ||||||||||||||| |||| ||||||| |||||||||||| |||||    
29373517 cgtgagcttaactcagttggtaaggatattgcatattatatgcaggggccggggttcgaacctcagacaccccacttctccac 29373435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31327786 - 31327704
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
31327786 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 31327704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 37800679 - 37800597
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
37800679 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 37800597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40933899 - 40933817
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
40933899 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 40933817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 44652050 - 44651968
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| ||||||||| |||||    
44652050 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggataccccacttctccac 44651968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 47098734 - 47098816
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| | ||||| |||||| |||||    
47098734 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccac 47098816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 50496882 - 50496800
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
50496882 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 50496800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 53432804 - 53432723
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
53432804 gtgagtttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 53432723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 25279129 - 25279045
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| | |||| || ||||||| ||| |||||| |||||||| | |||||||| |||||||||||||| |||||    
25279129 ctcgtgagcttagcttagttggtagggatattgtatattatatgtaggggccgggatttgaaccccggacaccccacttctccac 25279045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 32776214 - 32776289
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||| |||||    
32776214 gtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcactt 32776289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2522928 - 2523010
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||| | || | |||||||||| ||||||| |||||| |||||    
2522928 cgtgagcttagctcagttggtagggatattgcatattatatgcaagagctggggtttgaaccccggacactccacttctccac 2523010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6920031 - 6919949
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| || |||| |||||| |||||    
6920031 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccac 6919949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9176654 - 9176572
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||| | |||| |||| ||||| ||||||| |||||| |||||    
9176654 cgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactccacttctccac 9176572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10176971 - 10176889
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
10176971 cgtgaggttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 10176889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 366 - 440
Target Start/End: Complemental strand, 10952365 - 10952291
Alignment:
366 tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| || ||| |||||| ||||||||||||  |||| ||||| | ||||||||||||||||||    
10952365 tagctcaattggcagggacattacataatttatgcaggggcctgggttcgaacccccgacaccccacttatccac 10952291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 17440025 - 17439963
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    |||||||||||||||  |||||||||||||| ||||||||||| ||||||| || ||||||||    
17440025 tatatgcaggggccggtgtttgaacctcggataccccacttattcaccttataaggtgaattt 17439963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 18194340 - 18194422
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
18194340 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 18194422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22472382 - 22472300
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||| | |||| |||| ||||| |||||||||||||| |||||    
22472382 cgtgagcttaactcagttggtagagatattgcatattatatgcaagagccggggttcgaaccccggacaccccacttctccac 22472300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22501999 - 22501917
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||||    
22501999 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac 22501917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 385 - 451
Target Start/End: Complemental strand, 23653257 - 23653191
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||||||||||| || |||| ||||| || ||||| ||||||||||| ||||||||||    
23653257 attgcataatatatgcaggggtcggggttcgaaccccgaacacctcacttatccacattaaaatgtg 23653191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31327569 - 31327487
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| |||||    
31327569 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggaaactccacttctccac 31327487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33706795 - 33706713
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || |||||| |||| |||||||| | |||| |||| ||||| ||||||| |||||| |||||    
33706795 cgtgagcttagctcaattggtagggatattacatattatatgcaagagccggggttcgaaccccggacactccacttctccac 33706713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34898835 - 34898753
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | |||||||||||| |||||    
34898835 cgtgagcttagttcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccac 34898753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 37488528 - 37488446
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
37488528 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac 37488446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39966142 - 39966060
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||  | |||| ||||||| ||||| |||||| |||||    
39966142 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggttgaggttcgaacctcagacactccacttctccac 39966060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40548305 - 40548387
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||| || |||||    
40548305 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccac 40548387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 45701346 - 45701428
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| |||||    
45701346 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccac 45701428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 48739812 - 48739730
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||| | |||| ||||| | |||||||||||| |||||    
48739812 cgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccac 48739730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 50234126 - 50234208
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
50234126 cgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 50234208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52974121 - 52974039
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
52974121 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 52974039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 54769898 - 54769816
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || ||||||||||| |||||||||| ||||  ||| ||||| |||||||||||||| |||||    
54769898 cgtgagcttagcttagttggtagggatattgcatattatatgcaggtgccggagttcgaaccacggacaccccacttctccac 54769816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 458
Target Start/End: Original strand, 166786 - 166886
Alignment:
358 cgtgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||||||||||| |||| | | |||| |||||||| ||||||||||||| |||| ||||| | |||||| ||||||| |||||| ||| ||||||||    
166786 cgtgagcttagctcacttggtaagggataatgcataatttatgcaggggccggggttcgaaccccagacacctcacttattcacctttaaa-gtgaattt 166884  T
457 ct 458  Q
    ||    
166885 ct 166886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 466
Target Start/End: Original strand, 14868683 - 14868791
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| || ||||||||||||| ||| |||||| ||||| ||    
14868683 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcactttaaaa-gtgaaatt 14868781  T
457 ctatccacta 466  Q
    ||| ||||||    
14868782 ctagccacta 14868791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 24537862 - 24537923
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
24537862 tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 24537923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 431
Target Start/End: Complemental strand, 28550387 - 28550314
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca 431  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||||  ||| ||||  |||||||||||    
28550387 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaagttcgaactccggacacccca 28550314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 46328984 - 46328923
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
46328984 tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 46328923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 50724402 - 50724463
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||  | |||| |||||||||||||||||||||| |||||||||| |||||||    
50724402 tatatgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaagtgaatt 50724463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 50788446 - 50788385
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||  | |||| |||||||||||||||||||||| |||||||||| |||||||    
50788446 tatatgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaagtgaatt 50788385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 382 - 434
Target Start/End: Complemental strand, 5641658 - 5641606
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||| ||||||||||||||| |||| |||||||||||||| |||||    
5641658 gatattgcatattatatgcaggggccggggttcgaacctcggacacctcactt 5641606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 6488128 - 6488208
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||| || ||||||||||| |||||||||||||   |||| ||||| | ||||| |||||| |||||    
6488128 tgagcttagctcaattggtagggatattgcatattatatgcaggggctagggttcgaaccccagacactccacttctccac 6488208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 10959131 - 10959250
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || ||||  |||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
10959131 cgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 10959229  T
457 ctatccactatactacttgac 477  Q
    |||  ||||| ||||| ||||    
10959230 ctagtcactagactacctgac 10959250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 374 - 446
Target Start/End: Original strand, 17003820 - 17003892
Alignment:
374 ttggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa 446  Q
    ||||||| || |||||||||||||||||||  ||| |||||||||  ||||||||||||||||  ||||||||    
17003820 ttggcagggacattgcataatatatgcaggatccgaggtttgaacaccggacaccccacttattaaccttaaa 17003892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 17218492 - 17218572
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| |||||||| |||||| ||||  |||| ||||||| |||||| |||||    
17218492 tgagcttagctcagttggtagggatattgcatattatatgcaagggccggggttcaaaccccggacactccacttctccac 17218572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 362 - 434
Target Start/End: Original strand, 26942759 - 26942831
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||||  |||| ||||| | ||||||||||||    
26942759 agcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccgcagacaccccactt 26942831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 29559740 - 29559660
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| |||| || ||||||||||| |||||| || || || ||||||||| ||||||||||||||| |||||    
29559740 tgagcttaactcagttggtagggatattgcatattatatgtagaggtcggggtttgaacttcggacaccccacttctccac 29559660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 31586951 - 31587031
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| |||||||||||| ||  ||| ||| | |||||||||||||| |||||    
31586951 tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaatcccggacaccccacttctccac 31587031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Original strand, 38949683 - 38949758
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| || ||||||||||| |||||    
38949683 ttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccgaacaccccacttctccac 38949758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 472
Target Start/End: Original strand, 3955304 - 3955420
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcagggg--ccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaat 454  Q
    ||||||| ||||||||||| ||| || | ||||| || |||||||||||  ||| |||| ||||| |||||||||||||||| ||| |||||| |||||     
3955304 cgtgagcatagctcaattgacagggacaatgcattattatatgcaggggggccggggttcgaaccccggacaccccacttattcactttaaaaagtgaa- 3955402  T
455 ttctatccactatactac 472  Q
    ||||| |||||| |||||    
3955403 ttctagccactaaactac 3955420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4860163 - 4860245
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||  ||||||||||||| | |||| ||||| | |||||||||||| |||||    
4860163 cgtgagcttagctcagttggtacggatattgcattttatatgcaggggctgaggttcgaaccccagacaccccacttctccac 4860245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7269957 - 7270039
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||  ||||||| |||||| |||||    
7269957 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccac 7270039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7920322 - 7920404
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||| | |||| |||| ||||| ||||||| | |||| |||||    
7920322 cgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactcaacttctccac 7920404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 419 - 477
Target Start/End: Complemental strand, 12100174 - 12100116
Alignment:
419 ctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    |||||| || ||| |||| |||||||||| ||||||||||| |||||||||||||||||    
12100174 ctcggatactccatttattcaccttaaaaagtgaatttctagccactatactacttgac 12100116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 14795113 - 14795195
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || || ||||||||||||||||||| |||  ||||  |||| |||||||||||||| |||||    
14795113 cgtgagcttagcttagttggtagtgacattgcataatatatgcaggtgccagggttcaaaccccggacaccccacttctccac 14795195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17608387 - 17608305
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| || | |||| || ||||||||||| ||||||||||||||| |||| |||||  |||||| |||||| |||||    
17608387 cgtgagcttaacttagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccac 17608305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 28689740 - 28689658
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
28689740 cgtgaacttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 28689658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 29098694 - 29098816
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg-aattt 456  Q
    ||||| |||| |||| |||| || ||||||| ||| |||||||||||| || |||| ||||| ||||||||||| || ||||  || || |||| || ||    
29098694 cgtgaacttaactcagttggtagagatattgtatattatatgcaggggtcggggttcgaaccccggacaccccatttctccatatttaattgtgtaagtt 29098793  T
457 ctatccactatactacttgacca 479  Q
    ||| |||||| ||||||||||||    
29098794 ctagccactagactacttgacca 29098816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 31529026 - 31528944
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
31529026 cgtgagcttagctcagttggtagggatattgaatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 31528944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32144586 - 32144668
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || | ||||||||| |||||||||| |||| |||| ||||| ||||||||||| || |||||    
32144586 cgtgagcttagcttagttggtaggggtattgcatattatatgcaggagccggggttcgaaccccggacaccccatttctccac 32144668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33607007 - 33606926
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| |||||||||||||| || ||||||||||  |||||||||||| || |||| ||||| ||||||| |||||| |||||    
33607007 cgtgaacttagctcaattggtagggatattgcattttatatgcaggggtcg-ggttcgaaccccggacactccacttctccac 33606926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 366 - 440
Target Start/End: Original strand, 49447148 - 49447222
Alignment:
366 tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
49447148 tagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 49447222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 459
Target Start/End: Original strand, 49593919 - 49594017
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta 459  Q
    |||||||||| |||||| || || ||||||| ||||||||| ||   | ||||||||||| ||| ||||||||| | |||||||| | |||||||||||    
49593919 gagcttagctgaattggtagggacattgcattatatatgcaaggattggggtttgaaccttggataccccacttgttcaccttaagaggtgaatttcta 49594017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52309178 - 52309096
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| | |||||||||||| |||||    
52309178 cgtgagcttaactcagttggtagggatattgcatactatatgcaggagtcggggttcgaaccccagacaccccacttctccac 52309096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52410309 - 52410227
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| | || ||||| | ||||| |||||| |||||    
52410309 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggattcgaaccccagacactccacttctccac 52410227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 52945897 - 52945978
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| || |||| |||||| |||||    
52945897 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacc-cgtacactccacttctccac 52945978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 53347358 - 53347276
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||| | | |||| ||||| | ||||| |||||| |||||    
53347358 cgtgagcttagctcagttggtagggatattgcatattatatgcagggactggggttcgaaccccagacactccacttctccac 53347276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 4227812 - 4227731
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||| |||||||| |||| || || |||||||||| |||||||||| || |||| ||||  |||||||||||||| ||||    
4227812 cgtgagtttagctcagttggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaccccacttctcca 4227731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 5636866 - 5636785
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||  |||||| | |||| |||||    
5636866 gtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactcgacttctccac 5636785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 9684998 - 9685079
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||| ||||||||||||||| || |||||||||| ||||||||||| | |||| ||| | || |||| |||||| ||||    
9684998 cgtgagcatagctcaattggcagggacattgcataatttatgcaggggctggggttcgaatcccgaacactccacttctcca 9685079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 19999869 - 19999930
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| |||||    
19999869 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc 19999930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 429
Target Start/End: Original strand, 20489819 - 20489888
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc 429  Q
    ||||||||||||| |||| || | ||||||||| |||||||||||||||  ||| ||||| |||||||||    
20489819 tgagcttagctcagttggtagggttattgcatattatatgcaggggccggagttcgaaccccggacaccc 20489888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 24130594 - 24130643
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||||||||||| || |||||||||| |||||||||||||||| ||||||    
24130594 tatatgcaggggacggggtttgaaccccggacaccccacttattcacctt 24130643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 25884027 - 25883974
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||| || |||| ||||| |||||||||||||| |||||    
25884027 tgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctccac 25883974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 27394542 - 27394591
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||| | |||||||||| |||||||||||||||| ||||||    
27394542 tatatgcaggggctggggtttgaaccccggacaccccacttattcacctt 27394591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 33206792 - 33206853
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||| | |||| ||||| |||||||||||||||| ||||||| || |||||||    
33206792 tatatgcaggggctggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 33206853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 43566856 - 43566795
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||||| |||||||||||||| ||||||| || |||||||    
43566856 tatatgcaggggtcggggttcgaacctcagacaccccacttattcaccttataaggtgaatt 43566795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 44764722 - 44764804
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| |||| || || |||||||||| |||||||||||   |||| ||||| ||||||| |||||| |||||    
44764722 ctcgtgagcttagctcagttggtagggacattgcataatttatgcaggggc--gggttcgaaccccggacactccacttctccac 44764804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 46795997 - 46795936
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||||| |||| |||||    
46795997 cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacc 46795936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 48251575 - 48251656
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||  || ||||||||||| |||||||||| |||| |||| |||||  |||||| |||||| |||||    
48251575 gtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttagaaccctggacactccacttctccac 48251656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 52030156 - 52030240
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| |||| ||||| ||||||||| |||||| ||| |||||| |||||||| || ||||||  |||| ||||||    
52030156 tatatgcaggggccggggttcgaaccccggacaccctacttattcactttaaaa-gtgaatttttagccactaggctacctgacca 52030240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 53577958 - 53578039
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||| ||||||| |||||||| | |||| |||| ||||| ||||||| |||||| |||||    
53577958 gtgagcttagctcagttggtagggatgttgcatattatatgcaagagccggggttcgaaccccggacactccacttctccac 53578039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 439
Target Start/End: Complemental strand, 3614147 - 3614067
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||||||  |||| || || |||||||||| ||||||||||| | |||| ||||| | |||||||||||| ||||    
3614147 gtgagcttagctctgttggtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctcca 3614067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 362 - 434
Target Start/End: Complemental strand, 4640544 - 4640472
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||||||| |||| ||||||    
4640544 agcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacctcgaacactccactt 4640472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 396 - 479
Target Start/End: Complemental strand, 24136810 - 24136726
Alignment:
396 tatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||  || | ||||| |||||||||||||||| ||| || |||| ||||||||||| ||||||  |||||||||||    
24136810 tatgcaggggccagggatcgaaccccggacaccccacttattcactttaaaaaggtgaatttctagccactaggctacttgacca 24136726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 432
Target Start/End: Original strand, 28951720 - 28951792
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    |||||||| |||||||||||  || |||||||||| ||||||||||| | |||| ||||| | ||||||||||    
28951720 tgagcttaactcaattggcaaggacattgcataatttatgcaggggctggggttcgaaccccagacaccccac 28951792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 443
Target Start/End: Original strand, 40160732 - 40160819
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||| ||||||||||||||| || || ||||  | |||||| ||||| | |||||||||| |||||||||||||||| ||||||    
40160732 ctcgtgagcatagctcaattggcagggacat-gcattgttatatgccggggctggggtttgaaccccggacaccccacttattcacctt 40160819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 48546175 - 48546251
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||||  || |||| ||||| |||||||| |||||    
48546175 cgtgagcttagctcagttggtagtgatattgcatattatatgtagggatcggggttcgaaccccggacacctcactt 48546251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 51155158 - 51155078
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| ||  |||||| ||| |||||| |||||| | |||| ||||||| |||||||||||| |||||    
51155158 tgagcttagctcagttggtaggaatattggatattatatgtaggggctggggttcgaacctccgacaccccacttctccac 51155078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 393 - 477
Target Start/End: Complemental strand, 54983766 - 54983683
Alignment:
393 atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    ||||||||||||| || |||| ||||| ||||||||||| |||| ||||||| || ||||| ||||| |||||| ||||| ||||    
54983766 atatatgcaggggtcggggttcgaaccccggacaccccatttattcaccttataaggtgaa-ttctagccactaaactacctgac 54983683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 356 - 419
Target Start/End: Original strand, 2368936 - 2368999
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||||| |||  || ||||||||||| ||||||||||||| | |||| |||||    
2368936 ctcgtgagcttagctcagttgttagggatattgcatattatatgcaggggctggggttcgaacc 2368999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 396 - 455
Target Start/End: Original strand, 2732700 - 2732759
Alignment:
396 tatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||| | |||| ||||| |||||||||||||||| ||||||| || |||||||    
2732700 tatgcaggggcaggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 2732759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 3993767 - 3993681
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaat-gtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| |||||||||| ||||||||||| |||| ||| || ||||| ||||| ||||| ||||||  |||||||||||    
3993767 tatatgcaggggccgcggtttgaaccccggacaccccatttatgcactttgaaaatggtgaa-ttctaaccactaggctacttgacca 3993681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Original strand, 8125641 - 8125696
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt 413  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||| ||| ||||    
8125641 cgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggtt 8125696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 420
Target Start/End: Complemental strand, 11250660 - 11250597
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacct 420  Q
    |||||| ||||||||| |||| || ||||||||||| ||||||||||| ||| |||| ||||||    
11250660 tcgtgaacttagctcagttggtagggatattgcatattatatgcagggtccggggttcgaacct 11250597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 42108243 - 42108168
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| ||||||||| ||||| | || ||||| ||||| |||||||| |||||    
42108243 ttagctcagttggtagggatattgcatattatatgcagaggccgggtttcgaaccccggacgccccacttctccac 42108168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 46336571 - 46336488
Alignment:
358 cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||  | ||||||||||||||||| || |||| ||||| || ||||||||||| |||||    
46336571 cgtgagcttagctcagttggtagggataaatacataatatatgcaggggtcggggttcgaaccccgaacaccccacttttccac 46336488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 52984013 - 52984088
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||||||| |||| || ||||||||||| | |||||| ||| || |||| ||||| ||||||| ||||||    
52984013 gtgagcttagctcagttggtagggatattgcatattgtatgcaagggtcggggttcgaaccccggacactccactt 52984088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 54408611 - 54408536
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| ||||||| || |||||||||| ||||||| || || |||| ||||| ||||||||||| || |||||    
54408611 ttagctcatttggcagggacattgcataatttatgcagaggtcggggttcgaaccccggacaccccatttttccac 54408536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 882391 - 882473
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||||  | |||| |||||| |||||    
882391 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctgaacactccacttttccac 882473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3748670 - 3748588
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| ||||||||||||  | |||| ||||| |||||| | ||||| |||||    
3748670 cgtgagcttagctcagttggtagggatattgtatattatatgcaggggttggggttcgaaccccggacatctcacttctccac 3748588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3894546 - 3894628
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| |  ||||||||||| |||||||||| |||| |||| ||||  ||||||| |||||| |||||    
3894546 cgtgagcttagttcagttggtatggatattgcatattatatgcaggagccggggttcgaactccggacactccacttctccac 3894628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 4010078 - 4009992
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttctatccactatactacttgacca 479  Q
    |||||||||||||||  ||||||||| || |||||||| |||| |||||| |||||||  | ||||| ||||||  |||||||||||    
4010078 tatatgcaggggccgcagtttgaaccccgaacaccccatttattcaccttgaaaatgttgaattctaaccactaggctacttgacca 4009992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 4237047 - 4236974
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||||||||| ||| |||| || || |||||||||| |||||||||| || |||| ||||| ||||||||||||    
4237047 cgtgagcttagttcagttggtagggacattgcataatttatgcagggg-cggggttcgaaccccggacaccccac 4236974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4880171 - 4880253
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||  ||||||||| ||| | |||| ||||| | |||||||||||| |||||    
4880171 cgtgagcttagctcagttggtacggatattgcattttatatgcagtggctgaggttcgaaccccagacaccccacttctccac 4880253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 447
Target Start/End: Original strand, 7517942 - 7518028
Alignment:
362 agcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||||| |||| | | ||||||||| ||| | |||||| |||| |||| ||||| || |||||||||||||||| |||||||    
7517942 agcttagctcatttggtaagggatattgcacaatttgtgcaggagccgcggttcgaaccccgaacaccccacttatccatcttaaaa 7518028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10482921 - 10482839
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||  ||||||| |||||| |||||    
10482921 cgtgaacttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttctccac 10482839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17728994 - 17729075
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||   | ||||||||||| |||||||||||| || |||| |||||  |||||| |||||| |||||    
17728994 cgtgagcttagctcaattgattg-gatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac 17729075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19030223 - 19030304
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||   | ||||||||||| |||||||||||| || |||| |||||  |||||| |||||| |||||    
19030223 cgtgagcttagctcaattgattg-gatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac 19030304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19996520 - 19996438
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| |  | |||| ||||| ||||||| |||||| |||||    
19996520 cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccggacactccacttctccac 19996438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Complemental strand, 24751320 - 24751278
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| |||| ||||| ||||||||||||||||    
24751320 tatatgcaggggccggggttcgaaccccggacaccccacttat 24751278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 25833829 - 25833906
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| |  ||||||||||| |||||||||| | || |||| |||||||| |||| ||||||||||||    
25833829 agcttagctcagttggtaaagatattgcatattatatgcaggag-cggggttcgaacctcgaacactccacttatccac 25833906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 385 - 451
Target Start/End: Original strand, 26880206 - 26880272
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||| |||||||||| || |||| |||| || |||||||||||| ||||| || |||||||    
26880206 attgcataatttatgcaggggtcggggttcgaacttcagacaccccacttctccacatttaaatgtg 26880272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 27329964 - 27329918
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||||| |||||||||||||| |||||    
27329964 tatatgcaggggccggggttcgaaccccggacaccccacttctccac 27329918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 436
Target Start/End: Original strand, 32421371 - 32421425
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    |||| ||||||||||||||||||| || |||| |||||||| || ||||||||||    
32421371 gataatgcataatatatgcaggggtcggggttcgaacctcgaactccccacttat 32421425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32828443 - 32828525
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||  |||| || ||||||||||| |||||||||| || | |||||||| | | ||||| |||||| |||||    
32828443 cgtgagcttagctcggttggtagggatattgcatattatatgcaggagctgaggtttgaatcccagacactccacttttccac 32828525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33225416 - 33225334
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  |||||||||| |||| |||| ||||| | ||||| |||||| |||||    
33225416 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccac 33225334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 36476357 - 36476478
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| || |||||||||||  || | ||||| || ||||||||||||||  ||| ||||| || ||||||||||||| ||| |||||| |||||||     
36476357 cgtgagcataactcaattggcacggacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttattcactttaaaa-gtgaattc 36476455  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
36476456 ctagccactaggctacctgacca 36476478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40192158 - 40192240
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||| || ||  ||| ||| | ||||||| |||||| |||||    
40192158 cgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcggtgttcgaatcccggacactccacttctccac 40192240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #140
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 44625257 - 44625211
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||||| |||||||||||||| |||||    
44625257 tatatgcaggggccggggttcgaaccccggacaccccacttctccac 44625211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #141
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45551877 - 45551795
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  |||||| |||||||| | || ||||| ||||||| |||||| |||||    
45551877 cgtgagcttagctcagttggtagggatatcgcattttatatgtaggggccgggattcgaaccccggacactccacttctccac 45551795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #142
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 472
Target Start/End: Original strand, 49146119 - 49146196
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac 472  Q
    |||||||||||| || |||| ||||| |||||||||||||||| ||| ||| || ||||| ||||| |||||| |||||    
49146119 tatatgcaggggtcggggttcgaaccccggacaccccacttattcactttataaggtgaa-ttctagccactaaactac 49146196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #143
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 466
Target Start/End: Complemental strand, 49750475 - 49750365
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac-cttaaaatgtgaatt 455  Q
    |||||||||||||||| |||  || ||||||||||| ||||||||||||| | |||| |||   | |||||||||||| | |||  ||||||||||||      
49750475 tcgtgagcttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaattccagacaccccacttcttcacatttaaaatgtgaagc 49750376  T
456 tctatccacta 466  Q
    |||| ||||||    
49750375 tctagccacta 49750365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #144
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 356 - 434
Target Start/End: Original strand, 50659590 - 50659668
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||||| |||| |||| || |||||  |||  ||||||||||||||| |||| ||||| ||||||| ||||||    
50659590 ctcgtgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccactt 50659668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #145
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 429
Target Start/End: Original strand, 51772892 - 51772962
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc 429  Q
    ||||||||| || | |||| || ||||||||||| |||||||||||| || |||| ||||||| |||||||    
51772892 gtgagcttaacttagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcagacaccc 51772962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #146
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 51879133 - 51879179
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||||| |||||||||||||| |||||    
51879133 tatatgcaggggccggggttcgaaccccggacaccccacttctccac 51879179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #147
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 53467984 - 53468033
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||||||||| | |||| |||||||||||||||||||||| |||||||    
53467984 tatatgcaggggcgg-ggttcgaacctcggacaccccacttattcacctta 53468033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #148
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 54349904 - 54349826
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||| |||| |||||| || ||||||||||| |||||||||||| ||  |||  ||||||||||||| ||||| |||||    
54349904 agctcagcttaattggtagggatattgcatattatatgcaggggtcggagttcaaacctcggacacctcacttctccac 54349826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 3973337 - 3973386
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| | |||||||| ||||||||||| |||| ||||||    
3973337 tatatgcaggggccgcgatttgaaccccggacaccccatttattcacctt 3973386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 3996539 - 3996490
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| | |||||||| ||||||||||| |||| ||||||    
3996539 tatatgcaggggccgcgatttgaaccccggacaccccatttattcacctt 3996490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 6951850 - 6951798
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||||||| || | ||||||||||||||||| ||||||| ||||||||||    
6951850 tatatgcaggggtcg-gatttgaacctcggacaccgcacttattcaccttaaaa 6951798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 14417903 - 14417964
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||| |  ||| ||||| |||||||||||||||| ||||||| || |||||||    
14417903 tatatgcaggggctggagttcgaaccccggacaccccacttattcaccttataaggtgaatt 14417964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 16886585 - 16886666
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || || |||||||| | ||| ||||||||| | ||  |||||| |||||||||||| |||||    
16886585 gtgagcttagctcagttggtagggacattgcatattgtatacaggggccgggattcaaacctcagacaccccacttttccac 16886666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 19550508 - 19550553
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagg 403  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||    
19550508 cgtgagcttagctcagttggtagggatattgcatattatatgcagg 19550553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 25938998 - 25938937
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    |||||| |||||||| |||| || ||||||||||| ||||||||||||| | |||| |||||    
25938998 cgtgagtttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc 25938937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 27983858 - 27983939
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| ||  |||||||||  |||||||||||| || |||||||||| | ||||| ||| || |||||    
27983858 gtgagcttagctcagttggtagaaatattgcattttatatgcaggggtcggggtttgaaccccagacactccaattctccac 27983939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 436
Target Start/End: Complemental strand, 29645890 - 29645845
Alignment:
391 taatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    |||||| ||||||||||| |||| ||||| ||||||||||||||||    
29645890 taatatgtgcaggggccggggttcgaaccccggacaccccacttat 29645845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 410 - 447
Target Start/End: Original strand, 31680783 - 31680820
Alignment:
410 ggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||| ||||||||||||||||| ||||||||||    
31680783 ggtttgaacttcggacaccccacttattcaccttaaaa 31680820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 31698568 - 31698629
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||| |||| |||| |||||||| ||||||||||||| || |||| || |||||||    
31698568 tatatgcaggagccggggttcgaacctcgaacaccccacttattcatcttataaggtgaatt 31698629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 32508854 - 32508793
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| || ||||||||||||| ||||||| || |||||||    
32508854 tatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt 32508793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 42271073 - 42271012
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||  ||||||||| |||||| ||||||| || |||||||    
42271073 tatatgcaggggccggggttcgaactccggacaccctacttattcaccttataaggtgaatt 42271012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 43774220 - 43774281
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| | |||||||||||||| ||||||| || |||||||    
43774220 tatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataaggtgaatt 43774281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 357 - 434
Target Start/End: Original strand, 45647304 - 45647381
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||| ||||||||||| |||| || || |||| |||| ||||||||||| || |||| ||||| |||||||| |||||    
45647304 tcgttagcttagctcagttggtagggacattgtataaaatatgcagggggcggggttcgaaccccggacacctcactt 45647381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 45871019 - 45871088
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    |||||| |||||||| |||| || ||||||| ||| |||||||||||| || |||| ||||| |||||||    
45871019 cgtgagtttagctcagttggtagggatattgtatattatatgcaggggtcggggttcgaaccccggacac 45871088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 366 - 451
Target Start/End: Complemental strand, 46817411 - 46817326
Alignment:
366 tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||| ||| || |||||||||| |||| || ||  | |||||||||| || ||||||||||| ||||| || |||||||    
46817411 tagctcaattgacagagacattgcataatttatgtagaggttggggtttgaaccccgaacaccccacttctccacatttaaatgtg 46817326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Complemental strand, 50536900 - 50536855
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagg 403  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||    
50536900 cgtgagcttagctcagttggtagagatattgcatattatatgcagg 50536855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #167
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 436
Target Start/End: Original strand, 54295238 - 54295283
Alignment:
391 taatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||| |||||||| |||| ||||||||||||| ||||||||    
54295238 taatatatgtaggggccggggttcgaacctcggacactccacttat 54295283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 55; Significance: 3e-22; HSPs: 162)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42044114 - 42044032
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| || |||||||||| ||||||||||||| |||||||||| |||||||||||||| |||||    
42044114 cgtgagcttagctcagttggcagagacattgcataatttatgcaggggccgaggtttgaaccccggacaccccacttctccac 42044032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 358 - 450
Target Start/End: Complemental strand, 11294906 - 11294814
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt 450  Q
    |||||||||| |||||||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| ||||| || ||||||    
11294906 cgtgagcttaactcaattggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccacatttaaatgt 11294814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 9692960 - 9693081
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| |||| ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
9692960 cgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 9693058  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
9693059 ctagccactaggctacctgacca 9693081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22788742 - 22788660
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||||||| | |||||||||||||| |||||    
22788742 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggtttgaatcccggacaccccacttctccac 22788660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 42411551 - 42411429
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | |||||||| ||||||||||| || |||| ||||| ||||||||||||||||  || |||||| ||||||||    
42411551 cgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatttactttaaaaagtgaattt 42411452  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||||||||||    
42411451 ctagccactaggctacttgacca 42411429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 51890799 - 51890881
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |||||    
51890799 cgtgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac 51890881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 8965096 - 8965172
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||||||||||    
8965096 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt 8965172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 29771368 - 29771285
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||||| || ||||||||||| ||||||||||||||| |||| ||||| ||| ||| |||||| |||||    
29771368 tcgtgagcttagctcaattggtagggatattgcatattatatgcaggggccggggttcgaaccccgggcactccacttctccac 29771285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 361 - 451
Target Start/End: Complemental strand, 38848186 - 38848095
Alignment:
361 gagcttagctcaattggcagcgatattgcat-aatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||||||||||| |||||||||| ||| |||||||||| || |||| ||||| |||||||||||||| ||||| || |||||||    
38848186 gagcttagctcaattggcagggatattgcataaatttatgcaggggtcggggttcgaaccccggacaccccacttctccacatttaaatgtg 38848095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3036123 - 3036041
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
3036123 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacaccccacttctccac 3036041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 21935483 - 21935561
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
21935483 agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 21935561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 28520828 - 28520707
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
28520828 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 28520730  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
28520729 ctagccactaggctacctgacca 28520707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 360 - 477
Target Start/End: Original strand, 29584648 - 29584765
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttct 458  Q
    ||||||||||||||||||||| || |||||||||| ||||||||||||| |||| ||||| |||||||| ||||||| | |||| |||| | |||||| |    
29584648 tgagcttagctcaattggcag-gacattgcataatttatgcaggggccgaggttcgaaccccggacacctcacttattctccttgaaaaggagaattttt 29584746  T
459 atccactatactacttgac 477  Q
    | ||||||  |||||||||    
29584747 agccactaggctacttgac 29584765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42002308 - 42002390
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || || |||||||||| |||| ||||||||||||||||||||| |||||||||||| |||||    
42002308 cgtgagcttagcttagttggtagggacattgcataatttatgtaggggccgtggtttgaacctcagacaccccacttctccac 42002390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 49901484 - 49901566
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||| ||| |||||    
49901484 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccgcttctccac 49901566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 368 - 451
Target Start/End: Original strand, 40486453 - 40486536
Alignment:
368 gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| ||||||| |||||| | ||| || |||||||    
40486453 gctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtg 40486536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 2629585 - 2629663
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||| || |||||||||| |||||||||| || |||| ||||| || ||||||||||| |||||    
2629585 agcttagctcaattggcagggacattgcataatttatgcaggggtcggggttcgaaccccgaacaccccacttctccac 2629663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4234353 - 4234271
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  || ||||||||||| |||||||||| |||| |||| ||||||||||||| |||||| |||||    
4234353 cgtgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttttccac 4234271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 11375957 - 11375875
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  || ||||||||||| ||||||||||||||| |||| ||||| |||||||| ||||| |||||    
11375957 cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcacttctccac 11375875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 13578533 - 13578451
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| |||||    
13578533 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac 13578451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33933807 - 33933725
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||||||||||||||||||| |||| || ||  ||||||||||||| |||||    
33933807 cgtgagcttagctcagttggtagggacattgcataatatatgcaggggccggggttcgacccctggacaccccacttctccac 33933725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43147452 - 43147370
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
43147452 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 43147370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43596897 - 43596979
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
43596897 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 43596979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 46105537 - 46105619
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
46105537 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 46105619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 46775098 - 46775016
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
46775098 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 46775016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 47934140 - 47934058
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
47934140 cgtgagcttagctcagttggtagggatatggcatattatatgcaggggccggggttcgaaccccggacactccacttctccac 47934058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 55251419 - 55251337
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
55251419 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 55251337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 366 - 466
Target Start/End: Original strand, 14149799 - 14149899
Alignment:
366 tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac 464  Q
    ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||||| ||||    
14149799 tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttctagccac 14149897  T
465 ta 466  Q
    ||    
14149898 ta 14149899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 31852351 - 31852432
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| ||||||| || |||| ||||| |||||| |||||| |||| ||||| |||||||||||||| ||||    
31852351 cgtgagcttagctcagttggcagggacattgtataatttatgcaagggccgaggttcgaaccccggacaccccacttctcca 31852432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 466
Target Start/End: Complemental strand, 48968307 - 48968199
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||| ||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
48968307 cgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 48968209  T
457 ctatccacta 466  Q
    ||| ||||||    
48968208 ctagccacta 48968199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 6371116 - 6371192
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||||||    
6371116 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt 6371192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 356 - 479
Target Start/End: Original strand, 8690210 - 8690333
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaat 454  Q
    ||||||||| ||||||| ||||||  || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| ||||||    
8690210 ctcgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaat 8690308  T
455 ttctatccactatactacttgacca 479  Q
    ||||| ||||||  |||| ||||||    
8690309 ttctagccactaggctacctgacca 8690333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 22230502 - 22230426
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||||||    
22230502 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt 22230426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 359 - 476
Target Start/End: Original strand, 46206580 - 46206705
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc--------tcggacaccccacttatccaccttaaaatgt 450  Q
    |||||||||||||| |||| || || ||||||| ||||||||||||| || | || |||||        ||||||||||||||||| |||||||| | ||    
46206580 gtgagcttagctcagttggtagggacattgcattatatatgcaggggtcgggattcgaaccccggacagtcggacaccccacttattcaccttaagaggt 46206679  T
451 gaatttctatccactatactacttga 476  Q
    ||||||||| ||||||| ||||||||    
46206680 gaatttctagccactatgctacttga 46206705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 52031205 - 52031324
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataa-tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||||||||||| |||||||  | | ||||| | |||||||||||| || |||| ||||| | |||||||||||||| ||| |||||| ||||||||    
52031205 cgtgagcttagctcagttggcaggaacaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaa-gtgaattt 52031303  T
457 ctatccactatactacttgac 477  Q
    ||| ||||||| |||| ||||    
52031304 ctagccactatgctacctgac 52031324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 55238567 - 55238491
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||| | |||| || ||||||||||| ||||||||||||||| |||||||| |||| |||| ||||||    
55238567 cgtgagcttagcttagttggtagggatattgcatattatatgcaggggccggggtttgaatctcgaacactccactt 55238491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 53376744 - 53376665
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| || ||||||||||  |||||||| |||||| |||| ||||| ||||||| |||||| |||||    
53376744 gagcttagctcaattggtagggatattgcatgttatatgcaagggccggggttcgaaccccggacactccacttctccac 53376665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3847683 - 3847765
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| || || ||||||| |||||| |||||    
3847683 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgatccccggacactccacttctccac 3847765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7686330 - 7686248
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||||| |||| |||||  |||||| |||||| |||||    
7686330 cgtgagcttagctcagttggtagagatattgcattttatatgcaggggccggggttcgaaccctggacactccacttctccac 7686248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 26868351 - 26868432
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
26868351 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctccac 26868432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34353781 - 34353863
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||| || |  |||| ||||| |||||||||||||| |||||    
34353781 cgtgagcttagctcagttggtagggatattgcatattatatgcagaggtcagggttcgaaccccggacaccccacttctccac 34353863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 39023177 - 39023259
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| |||||  |||||| |||||| |||||    
39023177 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac 39023259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45139949 - 45139867
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||| ||||| ||||||||||||| |||| ||||| |||||||| ||||| |||||    
45139949 cgtgagcttagctcagttggtagggacattgtataatttatgcaggggccggggttcgaaccccggacacctcacttctccac 45139867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 48569244 - 48569162
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||||    
48569244 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac 48569162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 50457782 - 50457700
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||| ||||||||||||||  |||| ||||| ||||||| |||||| |||||    
50457782 cgtgagcttagctcagttggtaaggatattgcatattatatgcaggggccagggttcgaaccccggacactccacttctccac 50457700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 393 - 479
Target Start/End: Complemental strand, 52330970 - 52330885
Alignment:
393 atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    |||||||||||||||| |||| ||||  |||||||||||||||| ||| |||||| ||||||||| | ||||||  |||||||||||    
52330970 atatatgcaggggccggggttcgaactccggacaccccacttattcactttaaaa-gtgaatttccaaccactaagctacttgacca 52330885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 53815694 - 53815815
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||| | |||| ||||| |||||||||||||||| |||  ||||| ||||||||    
53815694 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcactataaaa-gtgaattt 53815792  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
53815793 ctagccactaggctacctgacca 53815815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 56088018 - 56087940
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||  ||||||||||||||| |||| ||| | |||||||||||||| |||||    
56088018 agcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaatcccggacaccccacttctccac 56087940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 3784914 - 3785006
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||||||||||| || ||||||||||||| ||||||||| | | |||| ||||| || ||||| ||||| ||||| || |||||||    
3784914 cgtgagcttagctcaattggtagggatattgcataatttatgcagggtcag-ggttcgaaccccgaacaccacacttctccacatttaaatgtg 3785006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 451
Target Start/End: Complemental strand, 8848279 - 8848186
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca-cttatccaccttaaaatgtg 451  Q
    |||||||||| ||| |||| || ||||||||||| ||||| ||||||||| |||| ||||| |||||||||||  || ||||| ||||||||||    
8848279 gtgagcttagttcagttggtagggatattgcatattatatacaggggccggggttcgaaccccggacaccccatattctccacattaaaatgtg 8848186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 24234134 - 24234073
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||||||||| |||||||||||||||| || |||| || |||||||    
24234134 tatatgcaggggccggggtttgaaccccggacaccccacttattcatcttataaggtgaatt 24234073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 29406360 - 29406441
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||| || || |||||||||| |||||||||| || |||| ||||  |||||| ||||||| |||||    
29406360 gtgagcttagctcaattggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaacccacttctccac 29406441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 42395230 - 42395311
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| | |||| || ||||||||||| |||||| |||||||| |||| ||||  |||||||||||||| |||||    
42395230 gtgagcttagcttagttggtagggatattgcatattatatgtaggggccggggttcgaactccggacaccccacttctccac 42395311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 45112179 - 45112098
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||    
45112179 cgtgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcca 45112098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 47018006 - 47017945
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
47018006 tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 47017945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 32885723 - 32885794
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    |||||||||||| ||  ||| |||||||||||||||||||||| ||||||| || ||||| ||||||||||||    
32885723 tatatgcaggggtcggagttcgaacctcggacaccccacttattcaccttataaggtgaa-ttctatccacta 32885794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 55853176 - 55853100
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||||  ||| ||||| || ||| |||||||    
55853176 cgtgagcttagctcagttggtagagatattgcatattatatgcaggggccggtgttcgaaccccgaacatcccactt 55853100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 477
Target Start/End: Original strand, 25780513 - 25780632
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggaca-ccccacttatccacctt-aaaatgtgaatttc 457  Q
    |||||||| |||||||||||  || ||||||||||||||||||||| ||||||| ||||  |||||| || ||||||| | |||| |||| |  ||||||    
25780513 tgagcttaactcaattggcaaggacattgcataatatatgcaggggtcgtggttcgaacgccggacatcctcacttattcgccttgaaaaggaaaatttc 25780612  T
458 tatccactatactacttgac 477  Q
    ||  |||||| |||||||||    
25780613 tagtcactatgctacttgac 25780632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 396 - 455
Target Start/End: Original strand, 36257731 - 36257790
Alignment:
396 tatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||    
36257731 tatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaaagtgaatt 36257790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 355 - 434
Target Start/End: Complemental strand, 56479297 - 56479219
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||| |||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| ||||||||||||||    
56479297 tctcgtgaacttaactcagttggtagggatattgcatattatatgcaggggtcg-ggttcgaaccccggacaccccactt 56479219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 353 - 455
Target Start/End: Complemental strand, 56546550 - 56546448
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||| ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| ||| |||||| |||    
56546550 agtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccggggttcgaaccacagacaccccacttattcactttaaaaagtg 56546452  T
452 aatt 455  Q
    ||||    
56546451 aatt 56546448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 542882 - 542800
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  || ||||||||||| | ||||||||||| | |||| |||| |||||||| |||||| |||||    
542882 cgtgagcttagctcagttgatagggatattgcatattgtatgcaggggctggggttcgaacttcggacactccacttctccac 542800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 548947 - 548885
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||||||||||| |||| ||| ||| |||||||||||||| ||||||| || ||||||||    
548947 tatatgcaggggccggggttcgaaactcagacaccccacttattcaccttataaggtgaattt 548885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 637101 - 637183
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||  ||| ||  |||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
637101 cgtgagcttagctcagctggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 637183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 1458082 - 1458004
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||  || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
1458082 agcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 1458004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 2222565 - 2222623
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||  ||||||||||||||| |||| ||||| |||||||||||||| |||||    
2222565 gatattgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac 2222623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 472
Target Start/End: Original strand, 3465618 - 3465695
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac 472  Q
    |||||||||||||||  ||| ||||| |||||||||||||||| ||||||| || ||||| ||||| |||||| |||||    
3465618 tatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaa-ttctagccactagactac 3465695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4958624 - 4958542
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
4958624 cgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 4958542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10402443 - 10402525
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||||| ||  ||| ||||| |||||||| ||||| |||||    
10402443 cgtgagcttaactcagttggtagagatattgcatattatatgcaggggtcggagttcgaaccccggacacctcacttctccac 10402525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 385 - 451
Target Start/End: Original strand, 13088938 - 13089004
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||| |||||||||| || |||| ||| |||||||||||||||| ||||| ||||| ||||    
13088938 attgcataatttatgcaggggtcggggttcgaatctcggacaccccacttttccacattaaattgtg 13089004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 434
Target Start/End: Complemental strand, 13264340 - 13264266
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||| ||||| |||| || ||||||||||| |||||||| || ||| |||| ||||| ||||||||||||||    
13264340 tgagcttcgctcagttggtagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccactt 13264266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 18360495 - 18360577
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||  |||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
18360495 cgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccac 18360577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 393 - 443
Target Start/End: Complemental strand, 21765470 - 21765420
Alignment:
393 atatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||||||||||||||  |||| |||||||||||||||||||||| ||||||    
21765470 atatatgcaggggccaaggttcgaacctcggacaccccacttattcacctt 21765420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23924940 - 23924858
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| |||| ||||||||| || || |||||||||| ||||||||||||| |||| ||||| |||||||  ||||| |||||    
23924940 cgtgaacttaactcaattggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacttcacttctccac 23924858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25235865 - 25235783
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||||    
25235865 cgtgagcttagcttagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac 25235783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 27362897 - 27362815
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| ||||||||| |||| |||||||||||||||  ||| ||||| || || |||||||| |||||    
27362897 cgtgagcttaactcagttggtagcgatattacatattatatgcaggggccgacgttcgaaccccgaactccccacttctccac 27362815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 366 - 440
Target Start/End: Original strand, 30057232 - 30057306
Alignment:
366 tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||| || ||||||||||| |||||||||||| || ||||  |||| |||||||||||||| |||||    
30057232 tagctcagttggtagggatattgcatattatatgcaggggtcggggttcaaaccccggacaccccacttctccac 30057306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 36008273 - 36008371
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| ||||||| ||||||| || | |||||  | |||||||||||||| |||| ||||| || ||||||||||||| ||||||| || |||||||    
36008273 cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt 36008371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36132231 - 36132313
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||||||||||||| ||  |||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
36132231 cgtgagtttagctcaattggtaggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 36132313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36602434 - 36602352
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||  |||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
36602434 cgtgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccacttctccac 36602352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 37251115 - 37251197
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| | |||||||| |||| |||| |||| |||||||| |||||| |||||    
37251115 cgtgagcttaactcagttggtagggatattgcatattttatgcaggagccggggttcgaacatcggacactccacttctccac 37251197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40051624 - 40051706
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| |||||  | |||| ||||| | |||||||||||| |||||    
40051624 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggtaggggttcgaaccccagacaccccacttctccac 40051706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42381181 - 42381099
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||  |||||| ||||| || |||| ||||||| |||||||||||| |||||    
42381181 cgtgaacttagctcagttggtagggatattgcatgttatatgtaggggtcggggttcgaacctcagacaccccacttctccac 42381099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43978010 - 43978091
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| || |||| |||||| |||||    
43978010 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacc-cgtacactccacttctccac 43978091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 49264528 - 49264610
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||| |||| || |||| || |||||||||  ||||||||||||| |||| ||||| |||||||||||||| |||||    
49264528 cgtgagtttaactcagttagcagagacattgcataacttatgcaggggccgaggttcgaaccccggacaccccacttctccac 49264610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 52757346 - 52757264
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||||||  |||||||||| ||||||||||||  | |||| |||| || ||||||||| || |||||    
52757346 cgtgagcttagctcagttggcaggaatattgcatattatatgcaggggttggggttcgaacttcagacaccccatttctccac 52757264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 55055918 - 55056000
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || | |||||| | ||||||||||||| |||| ||||| ||||||| |||||| |||||    
55055918 cgtgagcttagctcagttggtagggacaatgcatattttatgcaggggccgaggttcgaaccccggacacgccacttctccac 55056000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 55536382 - 55536463
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||| |||||||||| | || ||||||||||| |||||| |||||| |||||    
55536382 cgtgagcttagctcagttggtaaggatattgcatattatatgcaggag-cggggtttgaaccttggacactccacttctccac 55536463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 382 - 443
Target Start/End: Original strand, 6930577 - 6930638
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||||||||||||||| | ||  |||  |||||||||||||||| ||||||    
6930577 gatattgcataatatatgcaggggccgggattcaaactccggacaccccacttattcacctt 6930638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 478
Target Start/End: Complemental strand, 15640540 - 15640420
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| || |||| ||||||| || | ||||| || |||||||| |  || |||| ||||||| |||||||||||||| ||| |||||| ||||||||    
15640540 cgtgagcatatctcagttggcagagacaatgcattattatatgcagtgttcggggttcgaacctcagacaccccacttattcactttaaaa-gtgaattt 15640442  T
457 ctatccactatactacttgacc 478  Q
    ||| |||||| ||||| |||||    
15640441 ctagccactagactacctgacc 15640420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 17872089 - 17872170
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||| |||||| || ||||||||||| ||||| ||||||||| |||| ||  | |||| ||||||||| ||||    
17872089 cgtgagcttagcttaattggtagggatattgcatagtatatacaggggccggggttcgagtcccggagaccccacttctcca 17872170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 357 - 434
Target Start/End: Original strand, 20203427 - 20203504
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||||||||| |||| || ||||||||||| |||||||||| |||  ||||  ||| |||||||| ||||||    
20203427 tcgtgagcttagctcatttggtagagatattgcatattatatgcaggagccaaggttcaaacttcggacactccactt 20203504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 361 - 434
Target Start/End: Original strand, 25224477 - 25224550
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||| ||||| ||| || || |||||||||| |||||||||| ||  ||| ||||||||||||||||||||    
25224477 gagcttaactcaactggtagggacattgcataatttatgcaggggtcggagttcgaacctcggacaccccactt 25224550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 27308773 - 27308692
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||| |||||| || || |  |||||||||||||||||| || |||| |||| ||||||||| | ||||||||    
27308773 cgtgagcttagcttaattggtagggacaacgcataatatatgcaggggtcggggttcgaacttcggacacctcccttatcca 27308692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 38690666 - 38690743
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||||| |||||||||||| || |||| ||||| ||||||||||||||||    
38690666 tgagcttagctcacttggtaagggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttat 38690743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 40150508 - 40150592
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||| |||||| || |||| ||||| |||||||| ||||||| ||| |||||| ||||||||||||||| || ||||| ||||||    
40150508 tatatacaggggtcggggttcgaaccccggacacctcacttattcactttaaaa-gtgaatttctatccattagactacctgacca 40150592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 42081738 - 42081819
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||| ||||||| ||||||||||||| |||| |||||| | |||| ||| || |||||| |||||| |||||    
42081738 gtgagcttagttcagttggcagagatattgcataatttatgtaggggctggggttcgaatcttggacactccacttctccac 42081819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 44602487 - 44602548
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||||| |||| |||||    
44602487 cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacc 44602548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 46582637 - 46582718
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| |||||    
46582637 gtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccagacactccacttctccac 46582718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 47929272 - 47929329
Alignment:
383 atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||||||||||| || |||| |||||||||| ||||||||| |||||    
47929272 atattgcatattatatgcaggggtcgaggttcgaacctcggaaaccccacttctccac 47929329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 53698040 - 53697979
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| ||||||||||||||||  |||||| || |||||||    
53698040 tatatgcaggggccggggttcgaaccccggacaccccacttatttaccttataaggtgaatt 53697979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 12504713 - 12504629
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| |||| || |||||| |||||    
12504713 ctcgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccac 12504629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 387 - 431
Target Start/End: Complemental strand, 15334861 - 15334817
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacacccca 431  Q
    |||||||||||||||||||||  |||||||||| |||||||||||    
15334861 tgcataatatatgcaggggccagggtttgaaccccggacacccca 15334817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 21863951 - 21863871
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| | |||| ||  |||||||||||| ||||||   ||||||||| |||| ||||||||||||||| |||||    
21863951 tgagcttagcttagttggtaggaatattgcataatttatgcaaaagccgtggttcgaacatcggacaccccacttctccac 21863871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 21919812 - 21919732
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| | |||| ||  |||||||||||| ||||||   ||||||||| |||| ||||||||||||||| |||||    
21919812 tgagcttagcttagttggtaggaatattgcataatttatgcaaaagccgtggttcgaacatcggacaccccacttctccac 21919732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 406
Target Start/End: Complemental strand, 24680154 - 24680106
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggc 406  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||    
24680154 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggc 24680106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 26919536 - 26919460
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||  ||||||| ||||||    
26919536 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccactt 26919460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 406
Target Start/End: Original strand, 30217601 - 30217649
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggc 406  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||    
30217601 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggc 30217649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 406
Target Start/End: Original strand, 37935863 - 37935911
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggc 406  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||    
37935863 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggc 37935911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 356 - 439
Target Start/End: Original strand, 33530793 - 33530876
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||||| || ||||||||||| |||||| ||||  || |||| ||||| |||| || |||||| ||||    
33530793 ctcgtgagcttagcttaattggtagggatattgcatattatatgtagggatcggggttcgaaccccggatactccacttctcca 33530876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36099252 - 36099169
Alignment:
358 cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| |||||||||| || || |  |||||  ||||||||||||||| |||| ||||| |||||||||||||| |||||    
36099252 cgtgagctttgctcaattggtagggacaaatgcattttatatgcaggggccggggttcgaaccccggacaccccacttctccac 36099169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 459
Target Start/End: Original strand, 36954134 - 36954236
Alignment:
358 cgtgagcttagctcaa-ttggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| |||||||| ||||||| || | ||||| || ||||||||||| || |||| ||||| ||||||||||| |||| ||| |||||| |||||||    
36954134 cgtgagcatagctcaagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattcactttaaaa-gtgaatt 36954232  T
456 tcta 459  Q
    ||||    
36954233 tcta 36954236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Complemental strand, 41621335 - 41621288
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg 405  Q
    ||||||||||||||||||| ||| ||||||| ||||| ||||||||||    
41621335 cgtgagcttagctcaattgacagagatattgtataatttatgcagggg 41621288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 49056776 - 49056859
Alignment:
358 cgtgagctta-gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||||| |||| || || |||||||| |||||||||| ||||  ||| ||||| |||||||||||||| |||||    
49056776 cgtgagcttaagctcagttggtagggacattgcatattatatgcaggagccggagttcgaaccccggacaccccacttctccac 49056859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 451
Target Start/End: Original strand, 50512364 - 50512455
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||| |||| ||  |||||||||| ||||||||||||  | |||| ||||||| ||||||  |||| ||||| || |||||||    
50512364 tgagcttagctcagttggtaggaatattgcatattatatgcaggggttgaggttcgaacctctgacaccttacttctccacatttaaatgtg 50512455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 477
Target Start/End: Complemental strand, 54854275 - 54854155
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaat 454  Q
    ||||||| ||||||| ||||||| || || ||||||| |||||||||||| | |||| ||||| |||||| | ||||||| ||||||  |||| |||||     
54854275 cgtgagcatagctcagttggcagggacat-gcataattatatgcaggggctggggttcgaaccccggacatcacacttattcaccttgaaaaaagtgaa- 54854178  T
455 ttctatccactatactacttgac 477  Q
    ||||| |||||| ||||||||||    
54854177 ttctagccactagactacttgac 54854155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 624482 - 624564
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| |  || |||||||||| ||||||||||| | |||| ||||| | |||||||||||| |||||    
624482 cgtgagcttaactcagttggtaaggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccacttctccac 624564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 2275072 - 2275130
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||||  ||  ||||||||| |||||||||||||| |||||    
2275072 gatattgcatattatatgcagggatcgatgtttgaaccccggacaccccacttctccac 2275130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3764076 - 3763994
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||| |||| ||||||||||||| | |||| ||||| | || || |||||| |||||    
3764076 cgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaaccccagatactccacttctccac 3763994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3815062 - 3815144
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || ||||||||||| |||||||||| || | |||| ||||| |||| || |||||| |||||    
3815062 cgtgagcttagcttagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccac 3815144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4590248 - 4590330
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| ||||| ||||||| | |||| ||||| | ||||| |||||| |||||    
4590248 cgtgagtttagctcagttggtagggatattgcatattatatacaggggctgaggttcgaaccccagacactccacttctccac 4590330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 5165859 - 5165940
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||| ||||| ||||||||||||||| |||| ||||| | ||||| |||||| |||||    
5165859 cgtgagcttaactcagttggtagggatatcgcatattatatgcaggggccggggttcgaacc-ccgacactccacttctccac 5165940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 5179926 - 5179868
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
5179926 gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 5179868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 5305078 - 5304996
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| ||  |||| ||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
5305078 cgtgagcttatctcagttggtaggaatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccac 5304996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 352 - 477
Target Start/End: Complemental strand, 9285761 - 9285637
Alignment:
352 cagtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt 450  Q
    ||||| ||||||| |||||||||||| || || | ||||| || |||||||||| | | |||| ||||| | ||||||||||||||  |||||| || ||    
9285761 cagtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcagggtctggggttcgaaccccagacaccccacttattaaccttataaggt 9285663  T
451 gaatttctatccactatactacttgac 477  Q
    ||| ||||| |||||| ||||||||||    
9285662 gaa-ttctagccactagactacttgac 9285637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9761117 - 9761199
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| || | |||| ||||| |||||||  ||||| |||||    
9761117 cgtgagcttacctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccac 9761199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 12582072 - 12582014
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
12582072 gatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 12582014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 12820502 - 12820404
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| ||||||| ||||||| || | |||||  | ||||||||||| || |||| |||||  ||||||||||||||| ||||||| || |||||||    
12820502 cgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcaccttataaggtgaatt 12820404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 15604108 - 15604026
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||| ||||||  |||||||||||| || | || ||||| ||||||| |||||| |||||    
15604108 cgtgagcttagctcagttggtagggatgttgcattttatatgcaggggtcgggattcgaaccccggacactccacttctccac 15604026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 17617024 - 17616966
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
17617024 gatattgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac 17616966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23705221 - 23705139
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| || ||||||| || | |||| ||||| |||||||  ||||| |||||    
23705221 cgtgagcttagctcagttggtagggatattgcatattacatgcaggagctggggttcgaaccccggacacttcacttctccac 23705139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 31601841 - 31601891
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||||||||||| | || ||||| |||||||||||||||| |||||||    
31601841 tatatgcaggggccgagattcgaaccccggacaccccacttattcacctta 31601891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 35219568 - 35219487
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| || ||||||| | || |||| ||||| ||||||| |||||| |||||    
35219568 cgtgagcttagctcagttggtagggatattgcatatta-atgcaggagtcggggttcgaaccccggacactccacttctccac 35219487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 35230355 - 35230271
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaat--gtgaatttctatccactatactacttgac 477  Q
    |||||||| ||| || |||| ||||||||||||||||||||||  ||||| ||||  |||||||| || |||||| ||||||||||    
35230355 tatatgcatgggtcggggttcgaacctcggacaccccacttatttaccttgaaataggtgaattt-tagccactagactacttgac 35230271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 37868611 - 37868553
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||||||||||||| |  ||| |||||||||||||| ||||| |||||    
37868611 gatattgcatattatatgcaggggctggagttcgaacctcggacacctcacttctccac 37868553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 41897591 - 41897533
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| |||||| |||| |||||  | ||||||||||| |||||    
41897591 gatattgcataatatatgcacgggccgaggttcgaaccctgtacaccccacttctccac 41897533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 401
Target Start/End: Original strand, 43027292 - 43027334
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgca 401  Q
    ||||||||||||||||||| || |||| |||||||||||||||    
43027292 gtgagcttagctcaattggtagtgataatgcataatatatgca 43027334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43271785 - 43271703
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||  || ||||||||||| ||||||||||| ||  |||| ||||| | |||||||||||| |||||    
43271785 cgtgagcttagttcagttgatagggatattgcatattatatgcagggaccagggttcgaaccccagacaccccacttctccac 43271703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43481107 - 43481026
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || |||||||||   ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
43481107 cgtgagcttaactcagttggtagggatattgcactttatatgcaggggccggggttcgaacc-cggacactccacttctccac 43481026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #140
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 45126134 - 45126216
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| |||||||||| || | |||| ||||| | ||||| |||||| |||||    
45126134 cgtgagcttagctcagttggtagggatattgtatattatatgcaggagctgaggttcgaaccccagacactccacttctccac 45126216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #141
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 45849049 - 45849131
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| | ||||||||||| |  ||| |||||  |||||| |||||| |||||    
45849049 cgtgagcttagctcagttggtagggatattgcatattttatgcaggggctggagttcgaaccctggacactccacttctccac 45849131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #142
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 51512077 - 51511995
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||||| |||| || ||||||||||| ||||||| |  |||| |||| ||||| ||||||| |||||| |||||    
51512077 cgtgagctgagctcagttggtagggatattgcatattatatgctgtagccggggttcgaaccccggacactccacttctccac 51511995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #143
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 627049 - 626968
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| |||||||| |||| || ||||||||||| |||||||| | || | |||| ||||| ||||||| |||||| |||||    
627049 gtgagtttagctcagttggtagggatattgcatattatatgcaagagctggggttcgaaccccggacactccacttctccac 626968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #144
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 451
Target Start/End: Original strand, 2688122 - 2688191
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||| |||||||||| || |||||| ||| | ||||||||||| || ||||| || |||||||    
2688122 gatattgcatattatatgcaggagctgtggttcgaatcccggacaccccatttctccacatttaaatgtg 2688191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #145
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 7768848 - 7768795
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||| ||||| |||| ||||| |||||||||||||||| ||| ||||||    
7768848 tatatgcagaggccggggttcgaaccccggacaccccacttattcactttaaaa 7768795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 451
Target Start/End: Complemental strand, 9477480 - 9477411
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||| |||||||||||  |||||||  |||  | |||||||||||||| ||| ||||||||||    
9477480 gatattgcatattatatgcagggatcgtggttcaaactccagacaccccacttattcacattaaaatgtg 9477411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 9924891 - 9924975
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    |||||||||||| || |||| ||||| ||||||| |||||||| ||||||  |  |||||||| ||||||||| ||||| ||||||    
9924891 tatatgcaggggtcggggttcgaaccccggacactccacttattcaccttgtatggtgaattt-tatccactagactacctgacca 9924975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 10098160 - 10098244
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| | || ||||| |||||||||||||||| || |||| ||  |||| ||||| |||||| ||||| ||||||    
10098160 tatatgcaggggccgggattcgaaccccggacaccccacttattcatcttataagatgaa-ttctagccactagactacctgacca 10098244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 427
Target Start/End: Original strand, 19963808 - 19963853
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    ||||||||||| |||||||||||| || |||| |||||||||||||    
19963808 gatattgcatattatatgcaggggtcggggttcgaacctcggacac 19963853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Original strand, 20610774 - 20610827
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||||||||| |||| ||||  |||||| ||||||||| ||||||||||    
20610774 tatatgcaggggccggggttcgaactccggacatcccacttattcaccttaaaa 20610827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 26885495 - 26885418
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||||| | |||| |||| | ||||||| ||||||| |||| ||||| ||||||| ||||||||    
26885495 tgagcttagctcatttggcaggggataatgcacattatatgctggggccggggttcgaaccccggacactccacttat 26885418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 29257055 - 29256974
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| |||||||| ||||||| ||||||||||||| ||||||| ||||   ||| ||||| | |||||||| ||| |||||    
29257055 gtgaggttagctcagttggcagagatattgcataatttatgcagcggccagagttcgaaccccagacaccccgcttctccac 29256974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Original strand, 33076565 - 33076618
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||||||| || |||| ||||| ||||||||| |||||| ||||||||||    
33076565 tatatgcaggggtcggggttcgaaccccggacaccctacttattcaccttaaaa 33076618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 34773743 - 34773682
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||| | |||| ||||| |||||||||||||||| ||| ||| || |||||||    
34773743 tatatgcaggggctgaggttcgaaccccggacaccccacttattcactttataaggtgaatt 34773682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 37032239 - 37032178
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || | || ||||| |||||||||||||||| ||||||| || |||||||    
37032239 tatatgcaggggtcgggattcgaaccccggacaccccacttattcaccttataaggtgaatt 37032178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 43207671 - 43207716
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagg 403  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||    
43207671 cgtgagcttagctcagttggtagggatattgcatattatatgcagg 43207716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 46998435 - 46998354
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| |   |||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
46998435 gtgagcttagctcagttggtatgaatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccac 46998354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 478
Target Start/End: Original strand, 48512197 - 48512317
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | |||||  | ||||||||||||   |||| | ||| |||||||||||||||| ||||||| || ||||||||    
48512197 cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttcgtaccccggacaccccacttattcaccttataaggtgaattt 48512296  T
457 ctatccactatactacttgacc 478  Q
     || |||||| |||| ||||||    
48512297 -tagccactagactatttgacc 48512317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #159
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 51777846 - 51777939
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||| |||||||| || | ||| |||||||||| |||||||||||  || |||| ||||  |||||| ||||||| ||||| || |||||||    
51777846 cgtgagtttagctcagttagtagctatattgcatattatatgcagggatcggggttcgaactccggacatcccacttctccacatttaaatgtg 51777939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #160
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 397 - 466
Target Start/End: Complemental strand, 53355023 - 53354955
Alignment:
397 atgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    |||||||||||| |||| ||||| ||||||||||||||||  || ||||||  |||||||||| ||||||    
53355023 atgcaggggccggggttcgaaccccggacaccccacttatttactttaaaa-atgaatttctaaccacta 53354955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #161
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 55260380 - 55260299
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| | |||| || || |||||||||| |||| |||||| | |||| ||||||| ||||| |||||| |||||    
55260380 gtgagcttagcttagttggtagggacattgcataatttatgtaggggcagaggttcgaacctctgacactccacttctccac 55260299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #162
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 56555583 - 56555632
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||||||||||| || |||| |||||||| ||||||||||||| ||||||    
56555583 tatatgcaggggtcggggttcgaacctcgaacaccccacttattcacctt 56555632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 5e-21; HSPs: 107)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 17064928 - 17064844
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| ||||||||| || ||||||||||| |||||||||||||||  ||||||||| |||||||||||||| |||||    
17064928 ctcgtgagcttaactcaattggtagggatattgcatattatatgcaggggccgacgtttgaaccccggacaccccacttctccac 17064844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 1269235 - 1269153
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||||||||| ||||||||||||||   ||| |||||||||||||||||||| |||||    
1269235 cgtgagcttagctcaattggtagagatattgcatattatatgcaggggccaaagttcgaacctcggacaccccacttctccac 1269153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 6447577 - 6447456
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| || |||| ||||||| || | ||||| || |||||||||||||| |||| |||||||||||||||||||||| ||| ||||||  |||||||    
6447577 cgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcactttaaaa-atgaattt 6447479  T
457 ctatccactatactacttgacca 479  Q
    ||| |||||| ||||| ||||||    
6447478 ctaaccactacactacctgacca 6447456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 12891559 - 12891641
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||||||||||| |||||    
12891559 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccacttctccac 12891641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 13622014 - 13621932
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
13622014 cgtgagcttagctcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 13621932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 17545240 - 17545159
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||    
17545240 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctcca 17545159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 479
Target Start/End: Complemental strand, 4674914 - 4674791
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaat 454  Q
    ||||||||| ||||||| ||| ||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| ||||||    
4674914 ctcgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaat 4674816  T
455 ttctatccactatactacttgacca 479  Q
    ||||| |||||| ||||| ||||||    
4674815 ttctaaccactaaactacctgacca 4674791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 359 - 464
Target Start/End: Original strand, 1463870 - 1463975
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc 457  Q
    |||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||||    
1463870 gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttc 1463968  T
458 tatccac 464  Q
    || ||||    
1463969 tagccac 1463975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4417753 - 4417671
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
4417753 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 4417671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 5966831 - 5966952
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac-cttaaaatgtgaattt 456  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||  ||||| |||| | ||    
5966831 cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccacaattaaattgtg-agtt 5966929  T
457 ctatccactatactacttgacca 479  Q
    ||| |||||| ||||||||||||    
5966930 ctagccactagactacttgacca 5966952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6558803 - 6558885
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||||||||| |||||||||||| || |||| ||||  ||||||||| |||| |||||    
6558803 cgtgagcttagctcaattggtagggatattgcatattatatgcaggggtcggggttcgaactccggacaccctacttctccac 6558885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8968751 - 8968833
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
8968751 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 8968833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9125665 - 9125746
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |||||||||||||| |||||||| |||||| |||| ||||| |||||||| ||||| |||||    
9125665 cgtgagcttagctcagttggtagcgatattgcatattatatgca-gggccggggttcgaaccccggacacctcacttctccac 9125746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9835035 - 9835117
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
9835035 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 9835117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 12463758 - 12463840
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
12463758 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 12463840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 14641177 - 14641095
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||||||||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
14641177 cgtgagcttaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 14641095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 15241398 - 15241480
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  ||  |||||||||| |||||||||||| || |||| |||||||||||||||||||| |||||    
15241398 cgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccac 15241480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24477827 - 24477909
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||  |||||||||||||||||||   |||||| |||||||||||||||||||| |||||    
24477827 cgtgagcttagctcagttggtagggacgttgcataatatatgcagggtatgtggttcgaacctcggacaccccacttctccac 24477909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32505690 - 32505772
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
32505690 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 32505772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42916391 - 42916473
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||  ||||||||||||||| |||| ||||| |||||||||||||| |||||    
42916391 cgtgagcttagctcagttggtagggatattgtatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac 42916473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 8241054 - 8241134
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| |||||||| ||| || |||| ||||| |||||||||||||| |||||    
8241054 tgagcttagctcagttggtagggatattgcatattatatgcaagggtcggggttcgaaccccggacaccccacttctccac 8241134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 364 - 440
Target Start/End: Complemental strand, 20145626 - 20145550
Alignment:
364 cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| | |||| || ||||||||||||| |||||| |||||| |||| |||||||||||||||||||| |||||    
20145626 cttagcttagttggtagggatattgcataatttatgcaagggccggggttcgaacctcggacaccccacttctccac 20145550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 24033082 - 24033161
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| || ||||||||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
24033082 gagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacacgccacttctccac 24033161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3198329 - 3198411
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||||||||||||||||  | |||| ||||| ||||||||| |||| |||||    
3198329 cgtgagcttagctcagttggtagggacattgcataatatatgcaggggttgaggttcgaaccccggacaccctacttctccac 3198411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4745944 - 4745862
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||| |||| |||| ||||| ||||||| |||||| |||||    
4745944 cgtgagcttagctcagttggtagggatattgcatattatatgaaggagccggggttcgaaccccggacactccacttctccac 4745862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6518844 - 6518762
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
6518844 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac 6518762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11897250 - 11897332
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
11897250 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 11897332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 23155895 - 23155977
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||||||| || |||||||||| ||||||| ||||| |||| ||||  || |||||| |||| |||||    
23155895 cgtgagcttagctcaattggcagggacattgcataatttatgcagaggccgaggttcgaactccgaacacccaacttctccac 23155977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23292485 - 23292403
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  |||||||||||   | |||| |||||||||||||||||||| |||||    
23292485 cgtgagcttagctcagttggtagggatattgcatgttatatgcagggtttggggttcgaacctcggacaccccacttctccac 23292403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 32158510 - 32158413
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||||||| || || | ||||| || |||||||||||||| |||| ||||| || ||||||||||||| ||||||| || |||||||    
32158510 cgtgagcttagctcaattggtag-gacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt 32158413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 35515514 - 35515596
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||  ||||| |||||    
35515514 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacacttcacttctccac 35515596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 41179871 - 41179789
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| |||||    
41179871 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac 41179789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42525402 - 42525484
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
42525402 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 42525484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 10943751 - 10943812
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| |||||||    
10943751 tatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaaagtgaatt 10943812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 18928723 - 18928804
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||||| |||||||||| ||  ||| ||||| |||||||| ||||| |||||    
18928723 gtgagcttagctcagttggtagggatattgcataatttatgcaggggtcggtgttcgaaccacggacacctcacttttccac 18928804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 25400434 - 25400353
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
25400434 gtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 25400353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 32226288 - 32226231
Alignment:
383 atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||||||||||| || |||| |||||||||||||||||||| |||||    
32226288 atattgcatattatatgcaggggtcggggttcgaacctcggacaccccacttctccac 32226231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 546804 - 546880
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| |||||||| ||| |||||||    
546804 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcgaacatcccactt 546880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 1743129 - 1743204
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||||||    
1743129 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccactt 1743204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 17175117 - 17175037
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||| ||| |||| |||| || ||||||||||  ||||||||||||||| |||| ||||||||||||| |||||| |||||    
17175117 tgagtttaactcagttggtagggatattgcatgttatatgcaggggccggggttcgaacctcggacactccacttctccac 17175037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 450
Target Start/End: Original strand, 26912835 - 26912927
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt 450  Q
    |||||||||| ||||||||| || ||||||||||| |||||| |||||||| |||| ||||| |  |||||| |||| ||||| ||| |||||    
26912835 cgtgagcttaactcaattggtagggatattgcatattatatgtaggggccggggttcgaaccccaaacaccctacttctccacattataatgt 26912927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 18638603 - 18638682
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
18638603 gagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccacttctccac 18638682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2328594 - 2328676
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| |||||    
2328594 cgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccac 2328676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4067984 - 4068066
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || | |||||| | |||||||||| || |||| ||||| |||||||||||||| |||||    
4067984 cgtgagcttagctcagttggtagggacaatgcatattttatgcagggggcgaggttcgaaccccggacaccccacttctccac 4068066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 5900294 - 5900375
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||  |||||| |||||    
5900294 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggccg-ggttcgaaccccggacattccacttctccac 5900375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 436
Target Start/End: Complemental strand, 6614098 - 6614056
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| |||| ||||||||||||||||||||||    
6614098 tatatgcaggggccggggttcgaacctcggacaccccacttat 6614056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 397 - 455
Target Start/End: Original strand, 8015873 - 8015931
Alignment:
397 atgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
8015873 atgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 8015931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 11774527 - 11774445
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| || | || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
11774527 cgtgaccttagctcagtttgtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 11774445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 366 - 479
Target Start/End: Complemental strand, 20735264 - 20735151
Alignment:
366 tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac 464  Q
    ||||||| ||||||| || | ||||| || ||||| |||||||| |||| ||| | |||||||||||||||| ||| |||||| ||||||||||| ||||    
20735264 tagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttattcactttaaaa-gtgaatttctagccac 20735166  T
465 tatactacttgacca 479  Q
    ||  |||| ||||||    
20735165 taggctacctgacca 20735151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 21918054 - 21918136
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| |||||  |||||| |||||| |||||    
21918054 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctggacactccacttctccac 21918136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 27765259 - 27765341
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| |||||    
27765259 cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccac 27765341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36888463 - 36888381
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
36888463 cgtgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 36888381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 39919161 - 39919087
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||||||||||| | |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||||    
39919161 cgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac 39919087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43580880 - 43580962
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| |||||    
43580880 cgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac 43580962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 27241643 - 27241736
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||||| || | ||  ||||| |||| |||||||||||| || ||||| |||  |||| ||||||||| ||||| ||||||||||    
27241643 cgtgagcttagctcagtttgtaggaatattacatattatatgcaggggtcggggtttaaactccggataccccacttctccacattaaaatgtg 27241736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 30403785 - 30403846
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||| |||||||||  ||||||||| |||||||||||||||| ||||||| || |||||||    
30403785 tatatacaggggccggagtttgaaccccggacaccccacttattcaccttataaggtgaatt 30403846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 352 - 401
Target Start/End: Original strand, 30819226 - 30819275
Alignment:
352 cagtctcgtgagcttagctcaattggcagcgatattgcataatatatgca 401  Q
    ||||| |||||||||||||||||||| || |||||||||| |||||||||    
30819226 cagtcccgtgagcttagctcaattggtagagatattgcattatatatgca 30819275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 31250147 - 31250224
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| ||||||||||||||||    
31250147 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 31250224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 33729813 - 33729874
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||| ||| |||||||||||||| ||||||| || |||||||    
33729813 tatatgcaggggccggggttcgaatctcagacaccccacttattcaccttataaggtgaatt 33729874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 459
Target Start/End: Complemental strand, 36045194 - 36045130
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta 459  Q
    |||||||||||| || |||| ||||| |||||||||||||||| ||| |||||| |||||||||||    
36045194 tatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttcta 36045130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 38503352 - 38503275
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| ||||||||||||||||    
38503352 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 38503275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 38618741 - 38618680
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||| |||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
38618741 tatatgcaagggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 38618680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 43227866 - 43227943
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| ||||||||||||||||    
43227866 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 43227943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 16386807 - 16386727
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| |||| || |||||| |||||    
16386807 tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccacttctccac 16386727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 395 - 455
Target Start/End: Complemental strand, 19059063 - 19059003
Alignment:
395 atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||| |||| |||||  ||||||||||||||| ||||||| || |||||||    
19059063 atatgcaggggccggggttcgaaccctggacaccccacttattcaccttataaggtgaatt 19059003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 25346219 - 25346290
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||||| |||| ||| | |||||||||||| ||| ||| |||||| ||||||||||| ||||||    
25346219 tatatgcaggggccggggttcgaatcccggacaccccacgtattcactttaaaa-gtgaatttctagccacta 25346290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 432
Target Start/End: Complemental strand, 36564492 - 36564416
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    |||||||||||| || |||||| ||  |||||| ||||||||||| |||||||  ||| ||||| ||||||||||||    
36564492 ctcgtgagcttaacttaattggtaggaatattgtataatatatgctggggccggagttcgaaccacggacaccccac 36564416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 36716924 - 36716844
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| ||||  ||| || ||||||||||| ||||||||||| ||| |||||||||| ||||||| | |||| |||||    
36716924 tgagcttaactcagctggtagggatattgcatattatatgcagggaccggggtttgaaccccggacactcaacttctccac 36716844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Complemental strand, 18049689 - 18049642
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg 405  Q
    |||||||||||||||||||| || ||||||||||||| ||| ||||||    
18049689 cgtgagcttagctcaattggtagggatattgcataatttatacagggg 18049642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 353 - 455
Target Start/End: Original strand, 18477997 - 18478099
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||| ||||||| |||| || || | ||||| || |||||| ||||||| |||| |||||  ||||||||||||||| ||||||| || |||    
18477997 agtctcgtgagcatagctcagttggtag-gacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttattcaccttataaggtg 18478095  T
452 aatt 455  Q
    ||||    
18478096 aatt 18478099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 429
Target Start/End: Original strand, 24456192 - 24456262
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc 429  Q
    ||||||| ||||||||||||||| || |||||||||| |||||||||| ||  ||| ||||| |||||||||    
24456192 cgtgagcatagctcaattggcag-gacattgcataatttatgcaggggtcggagttcgaaccccggacaccc 24456262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 440
Target Start/End: Complemental strand, 33018590 - 33018512
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||| ||| || ||||||||||||| |||||| ||| || |||| |||| ||||||||||||||| |||||    
33018590 gagcttaactcaactggtagggatattgcataatttatgca-gggtcggggttcgaacttcggacaccccacttctccac 33018512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 373 - 440
Target Start/End: Complemental strand, 37553978 - 37553911
Alignment:
373 attggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| || |||||||||| ||||||| ||||| |||| ||||  | ||||||||||||||||||    
37553978 attggcagggacattgcataatttatgcagaggccgaggttcgaactccagacaccccacttatccac 37553911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 40276511 - 40276428
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||||||| |||| ||  |||||||||| ||||||||||||| | | || ||||| ||||| |||||||| |||||    
40276511 tcgtgagtttagctcagttggtaggaatattgcatattatatgcaggggctgagattcgaaccccggacgccccacttctccac 40276428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 385 - 447
Target Start/End: Complemental strand, 7064839 - 7064777
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||| |||||||||||| || | ||| ||| ||||||||||||||||| | ||||||||    
7064839 attgcatactatatgcaggggtcgggatttaaacatcggacaccccacttattctccttaaaa 7064777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 7631117 - 7631055
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    |||||| ||||| || ||||||||||||  ||||||||||||| ||| |||||| ||||||||    
7631117 tatatgtaggggtcgaggtttgaacctcaaacaccccacttattcacattaaaaagtgaattt 7631055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 13876385 - 13876307
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||  || ||||||| ||| ||||||||| ||||| |||| ||||| ||||||| ||| || |||||    
13876385 agcttagctcaattgatagagatattgtatattatatgcagcggccggggttcgaaccccggacactccatttctccac 13876307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 396 - 466
Target Start/End: Original strand, 16263775 - 16263845
Alignment:
396 tatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||| ||||  |||| ||||  |||||||||| |||||||||  ||||||||||| ||||||    
16263775 tatgcaggggccggggttctaaccccggattccccacttattcaccttaaagggtgaatttctagccacta 16263845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 17891891 - 17891845
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||||| |||||||||||||| |||||    
17891891 tatatgcaggggccggggttcgaaccccggacaccccacttctccac 17891845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 18050197 - 18050263
Alignment:
374 ttggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||| |||||||||||||| || ||||||||| || |||| ||||| ||||||| |||||| |||||    
18050197 ttggtagcgatattgcatattaaatgcaggggtcggggttcgaaccccggacactccacttctccac 18050263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 404
Target Start/End: Original strand, 19985502 - 19985548
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggg 404  Q
    ||||| ||||||||| |||| || |||||||||||||||||||||||    
19985502 cgtgaccttagctcagttggtagggatattgcataatatatgcaggg 19985548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25729508 - 25729426
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  |||||||||||| || |||| ||||| | ||||| |||||| |||||    
25729508 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaaccccagacactccacttctccac 25729426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32706324 - 32706406
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||| |||| |||||| ||| |||| | || ||||| ||||||| |||||| |||||    
32706324 cgtgagcttagctcagttggtagggatattacatattatatggaggagccgggattcgaaccccggacactccacttctccac 32706406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 33800928 - 33800978
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||||||||||| |||| ||||| | |||||||||||||| |||||||    
33800928 tatatgcaggggccggggttcgaaccccagacaccccacttattcacctta 33800978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 35241398 - 35241479
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||| |||||||||||| || |||| ||||| | ||||| |||||| |||||    
35241398 cgtgagcttagttcagttggtagagatattgcatattatatgcaggggtcggggttcgaacc-ctgacactccacttctccac 35241479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36124401 - 36124483
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  ||  |||||||||| |||||||||||| || |||| ||| | ||||||| |||||| |||||    
36124401 cgtgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaatcccggacactccacttctccac 36124483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39800098 - 39800016
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || | |||||||| ||||||||||| | || | ||||| | |||||||||||| |||||    
39800098 cgtgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggctcgaacccctgacaccccacttctccac 39800016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39886280 - 39886198
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||| ||| || | |||| ||||| ||||||| |||||| |||||    
39886280 cgtgagcatagctcagttggtagggatattgcatattatatgtaggagctggggttcgaaccccggacactccacttctccac 39886198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 40091479 - 40091561
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||| | |||| |||| ||||  ||||||| |||||| |||||    
40091479 cgtgagcttaactcagttggtagggatattgcatattatatgcaagagccgaggttcgaactccggacactccacttctccac 40091561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42320319 - 42320401
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | ||  ||| ||||| || |||| |||||| |||||    
42320319 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggagttcgaaccccgaacactccacttctccac 42320401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 410 - 479
Target Start/End: Original strand, 42355724 - 42355794
Alignment:
410 ggtttgaacctcggacaccccacttatccacc-ttaaaatgtgaatttctatccactatactacttgacca 479  Q
    |||||||||| |||||||||||||||| |||| |||| | ||||||||||| ||| ||  |||||||||||    
42355724 ggtttgaaccccggacaccccacttattcacctttaagaggtgaatttctagccattaggctacttgacca 42355794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 3535996 - 3535943
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||| |||| |||| |||| ||||| |||||||||||||||| ||||||||||    
3535996 tatatacaggagccggggttcgaaccccggacaccccacttattcaccttaaaa 3535943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 355 - 404
Target Start/End: Original strand, 6414067 - 6414116
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggg 404  Q
    ||||||||||||| |||| |||| || ||||||||||| |||||||||||    
6414067 tctcgtgagcttaactcagttggtagggatattgcatattatatgcaggg 6414116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 8478961 - 8478900
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    |||||| |||| ||| |||| || ||||||||||| ||||||||||||| |||||| |||||    
8478961 cgtgagtttagttcagttggtagggatattgcatattatatgcaggggctgtggttcgaacc 8478900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 439
Target Start/End: Original strand, 13958408 - 13958465
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||| |||||||||||| || |||| ||||| ||||||| |||||| ||||    
13958408 gatattgcatattatatgcaggggacggggttcgaaccccggacactccacttctcca 13958465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 18102009 - 18101956
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||||||||||  ||| ||||| | |||||||||||||| ||||||||||    
18102009 tatatgcaggggccggagttcgaaccccagacaccccacttattcaccttaaaa 18101956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 20945951 - 20945890
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| |||   |||||||||||||||| ||||||| || |||||||    
20945951 tatatgcaggggccggggttcgaaatccggacaccccacttattcaccttataaggtgaatt 20945890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 25648153 - 25648092
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| || ||||||| |||| |||| |||||    
25648153 cgtgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaacc 25648092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 29096368 - 29096307
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||| ||||||  ||| ||||| |||||||||||||||| ||||||| || |||||||    
29096368 tatatgcaagggccggagttcgaaccccggacaccccacttattcaccttataaggtgaatt 29096307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 29154846 - 29154926
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || |||| |||||| |||||| ||| |||| |||| ||||| ||||||| |||||| |||||    
29154846 gtgagcttagctcagttggtagggatagtgcatattatatgtaggagccg-ggttcgaaccccggacactccacttctccac 29154926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 356 - 413
Target Start/End: Original strand, 34436848 - 34436905
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt 413  Q
    ||||||||||||||||| |||| || || | ||||||||||||||| |||||| ||||    
34436848 ctcgtgagcttagctcagttggtagggacaatgcataatatatgcaagggccggggtt 34436905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 443
Target Start/End: Original strand, 34729495 - 34729555
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| ||||||    
34729495 gataatgcatattatatgcaggggtcggggttcgaacc-cggacaccccacttattcacctt 34729555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 433
Target Start/End: Original strand, 37034810 - 37034883
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact 433  Q
    |||||||||||||||||| || ||||| ||||  |||||||||| ||||  ||| ||||| ||||||| |||||    
37034810 tgagcttagctcaattggtagggatatcgcattttatatgcaggagccggagttcgaaccccggacactccact 37034883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 466
Target Start/End: Complemental strand, 37417226 - 37417119
Alignment:
358 cgtgagcttagctcaattggcagcgatattgca-taatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||||||||||| ||||||| || | | || || ||||||||||||||  |||| ||||| | |||||||||||||  ||| |||||| ||||||||    
37417226 cgtgagcttagctcagttggcagggacaatacattattatatgcaggggccagggttcgaacc-ctgacaccccacttactcactttaaaa-gtgaattt 37417129  T
457 ctatccacta 466  Q
    ||| ||||||    
37417128 ctagccacta 37417119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 355 - 408
Target Start/End: Complemental strand, 39028104 - 39028051
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg 408  Q
    ||||||||| |||||||| |||| || ||||||||||| |||||||| ||||||    
39028104 tctcgtgagattagctcatttggtagggatattgcatattatatgcaagggccg 39028051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 415
Target Start/End: Original strand, 41127021 - 41127078
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttg 415  Q
    ||||||||||||||| |||||||  | |||||||||| ||||||||||| | ||||||    
41127021 cgtgagcttagctcagttggcaggaacattgcataatttatgcaggggctggggtttg 41127078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 42455454 - 42455393
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||  ||| ||||| ||||||| |||||||| ||||||| || |||||||    
42455454 tatatgcaggggccggagttcgaaccccggacactccacttattcaccttataaggtgaatt 42455393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 52; Significance: 2e-20; HSPs: 97)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 358 - 477
Target Start/End: Complemental strand, 6658639 - 6658521
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc 457  Q
    ||||||||||||| | || | || || |||||||||||||||||||||||| |||| ||||| |||||||||||||||| | |||||||| | |||||||    
6658639 cgtgagcttagcttagttagtagggaaattgcataatatatgcaggggccggggttcgaaccccggacaccccacttattctccttaaaa-gagaatttc 6658541  T
458 tatccactatactacttgac 477  Q
    || ||||||  |||||||||    
6658540 tagccactaggctacttgac 6658521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2251840 - 2251922
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
2251840 cgtgagcttagctcagttggtagggatattgcatactatatgcaggggccggggttcgaaccccggacaccccacttctccac 2251922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32166371 - 32166453
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||||||||| ||||||||||||||| | |||||||| ||||||| |||||| |||||    
32166371 cgtgagcttagctcaattggtagggatattgcatattatatgcaggggccgggatttgaaccccggacactccacttctccac 32166453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 3640514 - 3640598
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| |||| || ||||||||||| |||||||| |||||| |||| ||||||||||||| |||||| |||||    
3640514 ctcgtgagcttagctcagttggtagggatattgcatagtatatgcaagggccggggttcgaacctcggacactccacttctccac 3640598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 492904 - 492986
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||  ||||||||||| ||||||||||||||| |||| |||||  ||||||||||||| |||||    
492904 cgtgagcttagctcagttggcaaggatattgcatattatatgcaggggccggggttcgaaccctggacaccccacttctccac 492986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7865423 - 7865341
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| ||||||||||  |||||| |||||| |||||    
7865423 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttgaaccctggacactccacttctccac 7865341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8297629 - 8297711
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||| ||||||  ||||||||||||||| |||| ||||| |||||||||||||| |||||    
8297629 cgtgagcttagctcaattggtagggatgttgcatgttatatgcaggggccggggttcgaaccccggacaccccacttctccac 8297711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 15091450 - 15091532
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||| | |||||||||||||| |||||    
15091450 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccac 15091532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 459
Target Start/End: Complemental strand, 20568353 - 20568251
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta-aaatgtgaattt 456  Q
    ||||||||||||||| |||| |  || ||||||||||||||||||||| || |||| ||||| || ||||||||||||| ||||||| ||| ||||||||    
20568353 cgtgagcttagctcagttggtaaggacattgcataatatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataaaggtgaattt 20568254  T
457 cta 459  Q
    |||    
20568253 cta 20568251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 216209 - 216290
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||| || ||||||||||  ||||||||||| | | |||| |||||||||||||||||||| |||||    
216209 gtgagcttagctcaattggtagggatattgcatgttatatgcagggtctggggttcgaacctcggacaccccacttctccac 216290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 3294766 - 3294842
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| ||||||||||||||    
3294766 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccactt 3294842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 6530264 - 6530182
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    ||||||||||||||| ||||  ||||||||||||||||||||| ||||||| || ||||| ||||| |||||| ||||||||||    
6530264 tatatgcaggggccggggttcaaacctcggacaccccacttattcaccttataaggtgaa-ttctagccactagactacttgac 6530182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7545331 - 7545413
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||  |||| ||||| || ||||||||||| |||||    
7545331 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccccgaacaccccacttctccac 7545413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 9435628 - 9435710
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| ||||||| |||||| |||||    
9435628 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccac 9435710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10934601 - 10934683
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
10934601 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 10934683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17441907 - 17441825
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
17441907 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 17441825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19953896 - 19953814
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
19953896 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 19953814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 355 - 440
Target Start/End: Original strand, 743562 - 743647
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||| |||| || ||||||||||| || ||||||| |||| |||| ||||| ||||||| |||||| |||||    
743562 tctcgtgagcttagctcagttggtagggatattgcatattagatgcaggagccggggttcgaaccccggacactccacttctccac 743647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 466
Target Start/End: Complemental strand, 14981799 - 14981691
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| |||||  ||||||||||||||| ||| |||||| ||||||||    
14981799 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattcactttaaaa-gtgaattt 14981701  T
457 ctatccacta 466  Q
    ||| ||||||    
14981700 ctagccacta 14981691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 430
Target Start/End: Original strand, 1968998 - 1969070
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccc 430  Q
    ||||||||||||||| |||| || |||||| |||| ||||||||||||||| |||| ||||| ||||||||||    
1968998 cgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacacccc 1969070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 32611620 - 32611540
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
32611620 tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 32611540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 365 - 451
Target Start/End: Original strand, 5694923 - 5695009
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||| ||| |||| || ||||||| ||| ||||||||||||  |  |||||||||||||||||||||||| ||||| ||||||||||    
5694923 ttaggtcagttggtagggatattgtatattatatgcaggggtaggagtttgaacctcggacaccccacttctccacattaaaatgtg 5695009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7207846 - 7207928
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||| || |||||    
7207846 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccatttctccac 7207928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 9064864 - 9064985
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| | ||||||||||||||  || |||||| ||||||||    
9064864 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatttactttaaaa-gtgaattt 9064962  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
9064963 ctagccactaggctacctgacca 9064985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9372269 - 9372187
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| |||||  |||||| |||||| |||||    
9372269 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccacttctccac 9372187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29284268 - 29284350
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||| ||||||||  ||| ||||| |||||||||||||| |||||    
29284268 cgtgagtttagctcagttggtagggatattgcatattatatgaaggggccggagttcgaaccccggacaccccacttctccac 29284350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 30704962 - 30705044
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||  |||||| |||||||| |||| ||||| |||||||||||||| |||||    
30704962 cgtgagcttagttcagttggtagggatattgcatgttatatgtaggggccggggttcgaaccccggacaccccacttctccac 30705044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31705901 - 31705983
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  |||||||||| ||||||| ||||| || |||| ||||| |||||||||||||| |||||    
31705901 cgtgagcttagctcagttggtatggatattgcattatatatgtaggggtcggggttcgaaccacggacaccccacttctccac 31705983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31802055 - 31802137
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
31802055 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 31802137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33573819 - 33573901
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||  |||||| |||||| |||||    
33573819 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccac 33573901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 7234000 - 7234049
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||| | ||||||||||||||||||||||||||| ||||||    
7234000 tatatgcaggggctggggtttgaacctcggacaccccacttattcacctt 7234049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19618796 - 19618712
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcata--atatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||||||||||||| || |||||||||||  |||||| ||||||| | |||| ||||| |||||||||||||| |||||    
19618796 cgtgagtttagctcaattggtagggatattgcatattatatatacaggggctggggttcgaaccccggacaccccacttctccac 19618712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 28030867 - 28030948
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||| ||||||||||||||  |||| |||||  |||||| |||||| |||||    
28030867 gtgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccctggacactccacttctccac 28030948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 31104884 - 31104977
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||| ||| |||  || |||||| |||| |||||||||||||||  ||| ||| | |||||||||||||| ||||| ||||||||||    
31104884 cgtgagcttagttcagttgatagggatattacatattatatgcaggggccggagttcgaatcccggacaccccacttctccacattaaaatgtg 31104977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 31935102 - 31935183
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||  |||||||||||| || |||| ||||| ||||||| |||||| |||||    
31935102 gtgagcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccac 31935183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 2816894 - 2816974
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||| || ||||||||||  ||||||||||||| | | || ||||  |||||||||||||| |||||    
2816894 tgagcttagctcaattggtagggatattgcatgttatatgcaggggctgagattcgaactccggacaccccacttctccac 2816974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 30938390 - 30938510
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaattt 456  Q
    |||||||||| |||| |||| || || |||||||||||||||||||| ||| |||| ||||| | ||||||| |||||| | |||| |||| | ||||||    
30938390 cgtgagcttaactcagttggtagggacattgcataatatatgcagggaccggggttcgaaccccagacaccctacttattctccttgaaaaggagaattt 30938489  T
457 ctatccactatactacttgac 477  Q
    |||  ||||| |||| |||||    
30938490 ctagacactaaactatttgac 30938510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 3795835 - 3795760
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||||| ||||| |||||| |||||    
3795835 ttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcagacactccacttctccac 3795760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 433
Target Start/End: Complemental strand, 5052141 - 5052066
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact 433  Q
    |||||||||||||||||||| || ||||| ||||  |||||||||| | || |||||||||| ||||||| |||||    
5052141 cgtgagcttagctcaattggtagggatatcgcattttatatgcaggagtcggggtttgaaccccggacactccact 5052066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Original strand, 22983615 - 22983697
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| || |||| || ||||| ||||| ||||||| |||| ||||    
22983615 tatatgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaa-ttctaaccactatgctacgtgac 22983697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Complemental strand, 23804793 - 23804711
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| || |||| || ||||| ||||| ||||||| |||| ||||    
23804793 tatatgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaa-ttctaaccactatgctacgtgac 23804711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 439
Target Start/End: Complemental strand, 32670120 - 32670041
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||||||||||| ||  |||||||||||| ||||||||||| | |||| ||||| | ||||||| |||| ||||    
32670120 tgagcttagctcaattggtaggaatattgcataatttatgcaggggcaggggttcgaacccctgacaccctacttctcca 32670041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 606989 - 607071
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||||||||| | || ||||||||||||| ||||||||| ||| |||| ||||  || ||||||||||| |||||    
606989 cgtgagcatagctcaattagtagggatattgcataatttatgcagggaccgaggttcgaactccgaacaccccacttctccac 607071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 978202 - 978120
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| || | || ||||||||||| |||||||||||| || |||| ||||  |||||||||||||| |||||    
978202 cgtgagtttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacaccggacaccccacttctccac 978120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 3448350 - 3448448
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| ||||||||||||||| || | |||||  | ||| |||||||||| |||| ||||| |||||||||||||||| || |||| || |||||||    
3448350 cgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaatt 3448448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 3794241 - 3794159
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| |||||    
3794241 cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccac 3794159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 432
Target Start/End: Original strand, 4408360 - 4408434
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| ||||    
4408360 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccacagacactccac 4408434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6210056 - 6210138
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||||    
6210056 cgtgaacttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac 6210138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7177297 - 7177379
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||  ||||||||||||| | |||| ||||| | |||||||||||| |||||    
7177297 cgtgagcttagctcagttggtagggatattgtattttatatgcaggggctggggttcgaaccccagacaccccacttctccac 7177379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 7897187 - 7897105
Alignment:
358 cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||| ||| |||| || ||||  ||||||||||||||||||| || |||| ||||| |||||||||||||| ||||    
7897187 cgtgagcttagatcagttggtagggataaatgcataatatatgcaggggtcggggttcgaaccccggacaccccacttctcca 7897105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9246450 - 9246368
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| |||||    
9246450 cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccacttctccac 9246368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10483604 - 10483522
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||  |||||||||||| || |||| ||||| ||||||| |||||| |||||    
10483604 cgtgatcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccac 10483522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10517201 - 10517283
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||  |||||||||||| || |||| ||||| ||||||| |||||| |||||    
10517201 cgtgagcttagctcagttggtatggatattgcattttatatgcaggggtcggggttcgaaccccggacactccacttctccac 10517283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 428
Target Start/End: Original strand, 16406571 - 16406641
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacc 428  Q
    ||||||||||| |||||||| || ||||||| ||||| ||||||||||| | |||||||||| | ||||||    
16406571 cgtgagcttagttcaattggtagagatattgtataatttatgcaggggctggggtttgaaccccagacacc 16406641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17454813 - 17454731
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
17454813 cgtgagcttatctcagttggtagagatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 17454731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 19279484 - 19279534
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    |||||||||||||||  ||| |||||||||||||||||||||| |||||||    
19279484 tatatgcaggggccggagttcgaacctcggacaccccacttattcacctta 19279534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19892344 - 19892262
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||| |||||| ||||| || |||| ||||| ||||||| |||||| |||||    
19892344 cgtgagcttagttcagttggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacactccacttctccac 19892262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 22997338 - 22997420
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| |||||| ||||| || |||| ||||| ||||||||| |||| |||||    
22997338 cgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccac 22997420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23791063 - 23790981
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||| ||| |||||| ||||| || |||| ||||| ||||||||| |||| |||||    
23791063 cgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctacttctccac 23790981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24319015 - 24319097
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||| ||| |||| || || |||||||||| ||||||||||||| |||| ||||| ||||||| |||||| |||||    
24319015 cgtgagtttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacactccacttctccac 24319097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 387 - 429
Target Start/End: Original strand, 32502215 - 32502257
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccc 429  Q
    |||||||||||||||||||||| |||||||||||| |||||||    
32502215 tgcataatatatgcaggggccgaggtttgaacctcagacaccc 32502257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 5134494 - 5134433
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||| ||||| |||| ||||||| |||||||||||||| ||||||| || |||||||    
5134494 tatatgcagaggccgcggttcgaacctcagacaccccacttattcaccttataaggtgaatt 5134433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 6228355 - 6228278
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| ||||||||||||||||    
6228355 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 6228278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 8857092 - 8857153
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || |||||| |||| ||||||||||||||| |||| |||||    
8857092 cgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaacc 8857153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 12089132 - 12089193
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||  ||| ||||| |||||||||||||||| ||||||| || |||||||    
12089132 tatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaatt 12089193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 18903462 - 18903385
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||||| | |||| | || ||||| ||||||||||| |||| ||||| ||||||||||||||||    
18903462 tgagcttagctcatttggcaagggataatacacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 18903385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 25020588 - 25020527
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||  |||| ||||| |||||||||||||||| ||||||| || |||||||    
25020588 tatatgcaggggcctgggttcgaaccccggacaccccacttattcaccttataaggtgaatt 25020527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 28237322 - 28237237
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtgg-tttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| |||| || ||||||||||| |||||||||| |||| || ||||||||  |||||| |||||| |||||    
28237322 ctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccac 28237237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 443
Target Start/End: Original strand, 32470712 - 32470769
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacacccc-acttatccacctt 443  Q
    |||||||||||||||||||| | |||||||||||| |||||||| |||||| ||||||    
32470712 tgcataatatatgcaggggctgaggtttgaacctcagacacccctacttattcacctt 32470769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 439
Target Start/End: Original strand, 361166 - 361246
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||  | |||||||||||| ||||    
361166 gtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaactccagacaccccacttctcca 361246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 418
Target Start/End: Complemental strand, 4869766 - 4869706
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaac 418  Q
    ||||||||||||||| |||| || |||| |||||| ||||||||||||||| |||| ||||    
4869766 cgtgagcttagctcagttggtagggatactgcatattatatgcaggggccggggttcgaac 4869706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 451
Target Start/End: Complemental strand, 11421053 - 11420962
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||||| |||||| || |||||||||| |||||| |||||| |||| ||| | |||||| ||| ||| ||||| || |||||||    
11421053 gtgagcttagctcaactggcagggacattgcataatttatgca-gggccggggttcgaaacccggacatcccgcttctccacgtttaaatgtg 11420962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 15964009 - 15963929
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| | ||||||||||| | |||| |||||  |||||| |||||| |||||    
15964009 tgagcttagctcagttggtagggatattgcatattttatgcaggggctggggttcgaaccctggacactccacttctccac 15963929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 364 - 440
Target Start/End: Complemental strand, 28148795 - 28148719
Alignment:
364 cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| |||| || ||||||||||| |||||||||| |||| | || ||||| ||||||| |||||| |||||    
28148795 cttagctcagttggtagggatattgcatattatatgcaggagccgggtttcgaaccccggacactccacttctccac 28148719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 32813718 - 32813642
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||| ||| |||| |  ||||||||||| ||||||||||||||| |||| ||||| |||| || ||||||    
32813718 cgtgagcttagttcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggatactccactt 32813642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 405
Target Start/End: Original strand, 8439677 - 8439724
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagggg 405  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||    
8439677 cgtgagcttagctcagttggtagggatattgcatattatatgcagggg 8439724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 359 - 477
Target Start/End: Original strand, 16119280 - 16119398
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt---aaaatgtgaatt 455  Q
    |||||| ||||||| ||||||| || || ||||||||||| ||||||||| |||| ||||| | ||||||| | |||| ||||||   |||||||||| |    
16119280 gtgagcatagctcagttggcagggaaat-gcataatatattcaggggccggggttcgaacc-ctgacaccctatttattcaccttaaaaaaatgtgaa-t 16119376  T
456 tctatccactatactacttgac 477  Q
    |||| |||||| ||||||||||    
16119377 tctagccactagactacttgac 16119398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 33646860 - 33646919
Alignment:
382 gatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| | ||||||||||| || |||| |||||||||||||||||||| |||||    
33646860 gatattgcatatttatatgcaggggtcggggttcgaacctcggacaccccacttctccac 33646919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 477
Target Start/End: Original strand, 4844178 - 4844262
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaatttctatccactatactacttgac 477  Q
    |||||||||||| || ||||| |||||| |||||| ||||||| ||||||  |||| ||||| ||||| |||||| ||||||||||    
4844178 tatatgcaggggtcggggtttaaacctcagacacctcacttattcaccttgaaaaaagtgaa-ttctaaccactagactacttgac 4844262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6419150 - 6419069
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||| |||| |||| || ||||||||||| ||||||||||| ||| |||| ||||| |||||| ||||||| |||||    
6419150 cgtgagtttaactcagttggtagagatattgcatattatatgcagggtccggggttcgaacc-cggacaacccacttctccac 6419069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 360 - 434
Target Start/End: Original strand, 7153792 - 7153866
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||| |||| |||| || ||||||||||  ||||||||||||||| |||| ||| | ||||||| ||||||    
7153792 tgagcttaactcagttggtagggatattgcatgttatatgcaggggccgaggttcgaatcccggacactccactt 7153866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 407
Target Start/End: Original strand, 7418279 - 7418329
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggcc 407  Q
    ||||||||||| |||| |||| || ||||||||||| ||||||||||||||    
7418279 tcgtgagcttaactcatttggtagggatattgcatattatatgcaggggcc 7418329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 9491795 - 9491745
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    |||||| |||||||| |||| ||||| |||||||||||||||| |||||||    
9491795 tatatgtaggggccggggttcgaaccccggacaccccacttattcacctta 9491745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 10424595 - 10424545
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    |||||| ||||| ||||||||||| | |||||||||||||||| |||||||    
10424595 tatatgtaggggtcgtggtttgaatcccggacaccccacttattcacctta 10424545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 10628616 - 10628698
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||  |||| || ||||||||||| ||||||||||||| |  ||| |||| |||||||||| |||| |||||    
10628616 cgtgagtttagctcggttggtagggatattgcatattatatgcaggggctggtgttcgaacatcggacaccctacttttccac 10628698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 448
Target Start/End: Complemental strand, 22730762 - 22730708
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaat 448  Q
    ||||||||||| | |  ||| |||||||||||||||||||||| |||||||||||    
22730762 tatatgcagggactgaagttcgaacctcggacaccccacttattcaccttaaaat 22730708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 26528602 - 26528652
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    |||||||||||| || ||||  ||||||||||||||||||||| |||||||    
26528602 tatatgcaggggtcggggttcaaacctcggacaccccacttattcacctta 26528652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 27667198 - 27667244
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||||| |||||||||||||| |||||    
27667198 tatatgcaggggccggggttcgaaccccggacaccccacttctccac 27667244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 30885638 - 30885556
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||| ||||||| | |||| ||||| | ||||| ||| || |||||    
30885638 cgtgagcttagctcagttggtagggatattgcatattatatacaggggctggggttcgaaccccagacactccatttctccac 30885556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #90
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 3299035 - 3298954
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||| |||||||| || |||||||||||  ||||||||||| ||   || |||||||| ||| ||||||| ||||    
3299035 cgtgagcttagatcaattggtagggatattgcatataatatgcaggggtcggaattcgaacctcgaacatcccacttctcca 3298954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #91
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 4854401 - 4854324
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||||| | |||| || | ||| | ||||||||||| |||| ||||| ||||||||||||||||    
4854401 tgagcttagctcatttggcaagggataatgtacaatgtgtgcaggggccggggttcgaaccccggacaccccacttat 4854324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 9704419 - 9704480
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||    
9704419 cgtgaacttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc 9704480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 12101921 - 12101982
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||  ||| ||||| ||||||||| |||||| ||||||| || |||||||    
12101921 tatatgcaggggccggcgttcgaaccccggacaccctacttattcaccttataaggtgaatt 12101982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 16251583 - 16251522
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| ||| ||| ||||  |||||||||||||||| ||||||| || |||||||    
16251583 tatatgcaggggtcgttgttcgaactccggacaccccacttattcaccttataaggtgaatt 16251522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Original strand, 24256951 - 24257000
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| |||| ||||| |||| ||||||||||| ||||||    
24256951 tatatgcaggggccgaggttcgaaccccggataccccacttattcacctt 24257000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 28222865 - 28222945
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||| |||| |||| |||| || ||||||||||| ||||||||| ||||| |||| ||||| ||||||| |||||| ||||    
28222865 cgtgaacttaactcagttggtagggatattgcatattatatgcagaggccggggttcgaacc-cggacactccacttctcca 28222945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 32283541 - 32283622
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||||| || || |||||||||| |||||| ||| || |||| ||||| | |||||  ||||| |||||    
32283541 gtgagcttagctcaattggtagggacattgcataatttatgcaagggtcggggttcgaaccccagacacttcacttttccac 32283622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0088 (Bit Score: 51; Significance: 8e-20; HSPs: 1)
Name: scaffold0088
Description:

Target: scaffold0088; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10894 - 10812
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
10894 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 10812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 51; Significance: 8e-20; HSPs: 119)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9877335 - 9877253
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
9877335 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 9877253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23102626 - 23102544
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
23102626 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 23102544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 360 - 450
Target Start/End: Original strand, 27788273 - 27788363
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt 450  Q
    ||||| ||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| | |||||||||||| ||||| || ||||||    
27788273 tgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgt 27788363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 360 - 450
Target Start/End: Original strand, 27791429 - 27791519
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt 450  Q
    ||||| ||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| | |||||||||||| ||||| || ||||||    
27791429 tgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccacttctccacatttaaatgt 27791519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 29658369 - 29658248
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| |||||||||||||||||| | |||||  | |||||||||||||| |||| ||||| |||||||||||||||| ||||||| || ||||| ||    
29658369 cgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaa-tt 29658271  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||||||||||    
29658270 ctagccactaggctacttgacca 29658248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 27424841 - 27424923
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||||||||| || |||||| |||||    
27424841 cgtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaacctcggatactccacttctccac 27424923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 15238891 - 15238972
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||    
15238891 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctcca 15238972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 451
Target Start/End: Original strand, 22774042 - 22774135
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||||||||| ||| || |||||||||| ||||||||||| | ||||  |||| |||||||||||||| ||||| || |||||||    
22774042 cgtgagcttagctcaattgacagggacattgcataatttatgcaggggcaggggttcaaaccccggacaccccacttctccacatttaaatgtg 22774135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 355 - 440
Target Start/End: Complemental strand, 30388578 - 30388493
Alignment:
355 tctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| | ||||| |||||| |||||    
30388578 tctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccacttctccac 30388493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 466
Target Start/End: Original strand, 42352652 - 42352760
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc 457  Q
    ||||||||| ||||| |||| || || ||||| |||||||||||||||||  |||||||||| ||||| |||||||||| | |||||||| | ||||||     
42352652 cgtgagctttgctcagttggtagggacattgcctaatatatgcaggggccagggtttgaaccccggacgccccacttattctccttaaaaagagaattta 42352751  T
458 tatccacta 466  Q
    || ||||||    
42352752 tagccacta 42352760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 358 - 472
Target Start/End: Complemental strand, 31475937 - 31475823
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || ||||||| || |||||||||||| | |||| ||||| | |||||||||||||| ||| |||||| ||||||||    
31475937 cgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttattcactttaaaa-gtgaattt 31475839  T
457 ctatccactatactac 472  Q
    ||| |||||| |||||    
31475838 ctagccactagactac 31475823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2228977 - 2229059
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| ||||| |||| ||  |||||||||| |||||    
2228977 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggtttaaaccccgagcaccccacttctccac 2229059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9712266 - 9712184
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| |||||    
9712266 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac 9712184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10244957 - 10244875
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||| |||| |||| ||||| |||||||||||||| |||||    
10244957 cgtgagcttagctcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacaccccacttctccac 10244875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19753036 - 19752954
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||||  |||||| |||||| |||||    
19753036 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccacttctccac 19752954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 29617407 - 29617489
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
29617407 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 29617489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36174392 - 36174474
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
36174392 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttttccac 36174474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 475
Target Start/End: Original strand, 8859716 - 8859833
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaat-gtgaatttc 457  Q
    ||||||||| ||||||||| || || ||| ||||||||||||||||| ||  ||| | |||||  ||||| ||||||| ||||||||||| |||||||||    
8859716 gtgagcttaactcaattggtagggaaattacataatatatgcaggggtcgatgttcgtacctcaaacacctcacttattcaccttaaaatggtgaatttc 8859815  T
458 tatccactatactacttg 475  Q
    || ||||||  |||||||    
8859816 tagccactaggctacttg 8859833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 14102496 - 14102557
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||||||||| |||||||||||||||| ||||||| || |||||||    
14102496 tatatgcaggggccggggtttgaaccccggacaccccacttattcaccttataaggtgaatt 14102557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 14412513 - 14412574
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||||||||| |||||||||||||||| ||||||| || |||||||    
14412513 tatatgcaggggccggggtttgaaccccggacaccccacttattcaccttataaggtgaatt 14412574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 48119473 - 48119554
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
48119473 gtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccac 48119554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 475
Target Start/End: Complemental strand, 8858777 - 8858661
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa-tgtgaatttct 458  Q
    ||||||||||||||||||||| || ||| ||||||||||| || || || |||| | |||||| ||||| || |||| | ||||||||  ||||||||||    
8858777 tgagcttagctcaattggcagggacattacataatatatgaagaggtcgaggttcgtacctcgaacacctcagttattccccttaaaagggtgaatttct 8858678  T
459 atccactatactacttg 475  Q
    | |||||| ||||||||    
8858677 agccactagactacttg 8858661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 359 - 427
Target Start/End: Complemental strand, 13730164 - 13730096
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    |||||||||||| | |||| || ||||||||||| ||||||||||||||| |||||||||| |||||||    
13730164 gtgagcttagcttagttggtagagatattgcatattatatgcaggggccggggtttgaaccccggacac 13730096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 28805304 - 28805384
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || |||||||||||  ||||||||||| || |||| ||||| |||||||||||||| |||||    
28805304 tgagcttagctcagttggtagggatattgcatatcatatgcaggggtcggggttagaaccccggacaccccacttctccac 28805384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 32677008 - 32676928
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
32677008 tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 32676928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 365 - 440
Target Start/End: Original strand, 9497975 - 9498050
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| || ||||||||||| |||||| ||||| || |||| ||||| |||||||||||||| |||||    
9497975 ttagctcaattggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacaccccacttctccac 9498050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 353 - 479
Target Start/End: Complemental strand, 22966059 - 22965934
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||| ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| ||||||| || |||    
22966059 agtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtg 22965961  T
452 aatttctatccactatactacttgacca 479  Q
    || ||||| |||||| ||||| ||||||    
22965960 aa-ttctaaccactagactacatgacca 22965934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 360 - 458
Target Start/End: Original strand, 27454011 - 27454110
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttct 458  Q
    ||||||||||||| |||| | | |||| |||| ||| | |||||||| || |||| |||||||||||||||||||||| || ||||||| ||||||||||    
27454011 tgagcttagctcatttggtaagggataatgcacaatttgtgcaggggtcgaggttcgaacctcggacaccccacttattcatcttaaaaggtgaatttct 27454110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 358 - 444
Target Start/End: Complemental strand, 36316070 - 36315984
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||| ||||||| |||| || |||| ||||| || |||||||||||||| |||| |||||||||||||||||||||| |||||||    
36316070 cgtgagcatagctcagttggtag-gataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcacctta 36315984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 36931976 - 36932051
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||| ||||||||| ||||||| || |||||||||| ||||||||| ||| |||| ||||| ||||||||||||||    
36931976 gtgaacttagctcagttggcagggacattgcataatttatgcagggtccggggttcgaaccccggacaccccactt 36932051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 368 - 434
Target Start/End: Complemental strand, 1563797 - 1563731
Alignment:
368 gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||||||||||    
1563797 gctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt 1563731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3766813 - 3766895
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
3766813 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 3766895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 12640657 - 12640575
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| |||||    
12640657 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccac 12640575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 21285450 - 21285352
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| ||||||| ||||||| || | |||||  | |||||||||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
21285450 cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 21285352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24781032 - 24781114
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| |||||    
24781032 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccacttctccac 24781114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 25711191 - 25711106
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta-aaatgtgaatttctatccactatactacttgacca 479  Q
    |||||| |||||||| |||| |||||||||||||||||||||| ||| ||| ||||||||| ||||||||||||  ||| |||||||    
25711191 tatatgtaggggccggggttcgaacctcggacaccccacttattcactttataaatgtgaa-ttctatccactaggctatttgacca 25711106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 31026221 - 31026303
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
31026221 cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 31026303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 35950130 - 35950212
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
35950130 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 35950212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36391972 - 36391890
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
36391972 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 36391890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 41331147 - 41331065
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| || |||||||||| |||||||||| || |||| |||   |||||||||||||| |||||    
41331147 cgtgagcttagctcagttggcagggacattgcataatttatgcaggggtcggggttcgaattccggacaccccacttctccac 41331065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42443691 - 42443773
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| |||||    
42443691 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac 42443773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 4169111 - 4169172
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||| |||||| |||||||||| |||||||||||||||| ||||||| || |||||||    
4169111 tatatgcaagggccggggtttgaaccccggacaccccacttattcaccttataaagtgaatt 4169172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 23755082 - 23755001
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||||| || || ||||||||||| | ||||||||||| | | || ||||||| |||||||||||| ||||    
23755082 cgtgagcttagctcaatcggtagggatattgcatattttatgcaggggctgagattcgaacctcagacaccccacttctcca 23755001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 37411804 - 37411723
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||||||| || || |||||||||| |||||||||| ||  ||||||||  |||||||||||||| |||||    
37411804 gtgagtttagctcaattggtagggacattgcataatttatgcaggggtcggagtttgaactccggacaccccacttctccac 37411723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 393 - 466
Target Start/End: Original strand, 47225195 - 47225268
Alignment:
393 atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||||||  ||| ||||||||||| ||||||||||   |||||||| ||||||||||| ||||||    
47225195 atatatgcaggggccggcgttcgaacctcggactccccacttatttcccttaaaaggtgaatttctagccacta 47225268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 48413993 - 48413912
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||||| ||||||||||| |||||||||| || | | || ||||  ||||||| |||||| |||||    
48413993 gtgagcttagctcaattggcagagatattgcatattatatgcaggagctgagattcgaactccggacactccacttctccac 48413912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 35612633 - 35612553
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||| || || |||||||| ||||||||| ||  | |||||||||| ||||||| |||||| |||||    
35612633 tgagcttagctcaattggtagggagattgcatattatatgcagaggttggggtttgaaccccggacactccacttctccac 35612553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 356 - 419
Target Start/End: Original strand, 3532578 - 3532641
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||| ||||| ||| |||| || ||||||||||||||||||||||||||| |||| |||||    
3532578 ctcgtgatcttagttcagttggtagggatattgcataatatatgcaggggccgaggttcgaacc 3532641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 356 - 439
Target Start/End: Original strand, 12772115 - 12772198
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| |||| || |||||| ||||    
12772115 ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggatactccacttctcca 12772198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 1398947 - 1398889
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||||||||||||||| |||| ||| | |||||||||||||| |||||    
1398947 gatattgcatattatatgcaggggccggggttcgaatcccggacaccccacttctccac 1398889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2681098 - 2681180
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| || ||| |||||    
2681098 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccccttctccac 2681180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 360 - 450
Target Start/End: Complemental strand, 15716751 - 15716661
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgt 450  Q
    |||| |||||||| |||| || |||||||| || |||||||| ||| || |||| |||| ||||||||||||||||| ||| || ||||||    
15716751 tgagtttagctcagttggtagggatattgcgtattatatgcaagggtcggggttcgaacttcggacaccccacttattcacatttaaatgt 15716661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 21066888 - 21066970
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||| |||||||| |||| ||||| |||||| | ||||| |||||    
21066888 cgtgagtttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacatctcacttctccac 21066970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23274882 - 23274800
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || || |||||||||| |||||||||||||  ||| ||||| ||||||||||| || |||||    
23274882 cgtgagcttagctaagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccatttttccac 23274800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 24061397 - 24061315
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||  |||||||||| |||||||||| |||| |||| ||||| || |||| |||||| |||||    
24061397 cgtgagcttagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccgaacactccacttctccac 24061315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 24188472 - 24188554
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || |||| |||||| |||||||||||| || |||| ||||| | |||||||||||| |||||    
24188472 cgtgagcatagctcagttggtagggatactgcatattatatgcaggggtcggggttcgaaccccagacaccccacttctccac 24188554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 25833557 - 25833639
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | || || |||||| |||||    
25833557 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccac 25833639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 27047775 - 27047725
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||||||||||| |||| ||||||||||||||||| |||| |||||||    
27047775 tatatgcaggggccggggttcgaacctcggacaccccatttattcacctta 27047725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 28444150 - 28444068
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
28444150 cgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccgaggttcgaaccccggacactccacttctccac 28444068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 30806117 - 30806199
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||||| ||  ||| ||||| |||||| ||||||| |||||    
30806117 cgtgagtttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaaccccggacatcccacttctccac 30806199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 30940773 - 30940855
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||| ||||| |||| ||| | || |||| |||||| |||||    
30940773 cgtgagcttagctcagttggtagtgatattgcatattatatgcagaggccggggttcgaatcccgaacacaccacttctccac 30940855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 436
Target Start/End: Original strand, 38378242 - 38378296
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    |||| |||| ||||| ||||||||||| |||||||||| ||||||||||||||||    
38378242 gataatgcacaatatgtgcaggggccggggtttgaaccccggacaccccacttat 38378296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 41417372 - 41417251
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| |||||||  | | ||||| || ||||||||||| || |||| ||||| | |||||||||||||| ||| |||||| ||||||||    
41417372 cgtgagcatagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaa-gtgaattt 41417274  T
457 ctatccactatactacttgacca 479  Q
     || ||| || ||||||||||||    
41417273 ttagccattagactacttgacca 41417251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 41465840 - 41465918
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||| |||||||||||| |  |||| ||||  |||||||||||||| |||||    
41465840 agcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacaccccacttctccac 41465918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 41853999 - 41854081
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| || |||||||||| |||||||||| ||  |||  |||| |||||||||| ||| |||||    
41853999 cgtgagcttagctcagttggcagggacattgcataatttatgcaggggacggagttcaaaccccggacaccccgcttctccac 41854081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 44616604 - 44616686
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| ||||  || | ||||||| |||||| |||||    
44616604 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcaaaacccggacactccacttctccac 44616686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 47463933 - 47464015
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| ||  |||||||||  ||||||||||||  | |||| |||||||||||||||||||| |||||    
47463933 cgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggttggggttcgaacctcggacaccccacttctccac 47464015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 47641047 - 47641129
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| |||||| | |||| ||||| | ||||| |||||| |||||    
47641047 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggctggggttcgaaccccagacactccacttctccac 47641129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 5787496 - 5787557
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||||||||| |  ||||||||||||| ||||||| || |||||||    
5787496 tatatgcaggggccggggtttgaaccccaaacaccccacttattcaccttataaggtgaatt 5787557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 16200562 - 16200643
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||||| ||  |||||||||| |||||||||||| || |||| ||||| | ||||||||| || |||||    
16200562 gtgagcttagcttaattggtaggaatattgcatattatatgcaggggtcggggttcgaaccccagacaccccatttctccac 16200643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 363 - 440
Target Start/End: Complemental strand, 18503543 - 18503466
Alignment:
363 gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||  |||| || ||||||||||| ||||||||||||| | |||| ||||| | |||||||||||| |||||    
18503543 gcttagctcggttggaagagatattgcatattatatgcaggggctgaggttcgaaccccagacaccccacttctccac 18503466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 36469773 - 36469692
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || |||||| |||| || ||||||| |||| |||| ||||| ||||||| |||||| ||||    
36469773 cgtgagcttagctcagttggtagggatattacatattacatgcaggagccggggttcgaaccccggacactccacttctcca 36469692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 37300167 - 37300106
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||||||||  |||||||||    
37300167 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggagtttgaacc 37300106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 38151347 - 38151428
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || |||||||||| || |||||||||| || |||| |||||  | ||||||||||| |||||    
38151347 gtgagcttagctcagttggtagggatattgcattatttatgcaggggtcggggttcgaaccatgaacaccccacttctccac 38151428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 479
Target Start/End: Original strand, 38451898 - 38451982
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| |||| ||| | |||||||||||||||| ||| ||| || ||||| ||||| |||||| ||||| ||||||    
38451898 tatatgcaggggccggggttcgaatcccggacaccccacttattcacattataaggtgaa-ttctagccactagactacctgacca 38451982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 40273821 - 40273898
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| ||||||||||||||||    
40273821 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 40273898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 41084041 - 41084102
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| |||||    
41084041 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacc 41084102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 427
Target Start/End: Complemental strand, 47255150 - 47255081
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    |||||||||| |||| ||||||| ||||||||||| ||| |||||| |||| |||| ||||| |||||||    
47255150 cgtgagcttaactcagttggcagagatattgcatattatctgcaggagccggggttcgaaccccggacac 47255081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 432
Target Start/End: Original strand, 21388527 - 21388599
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| ||||    
21388527 tgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac 21388599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 395 - 455
Target Start/End: Original strand, 34948142 - 34948202
Alignment:
395 atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||| ||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
34948142 atatgcagtggccgaggttcgaaccccggacaccccacttattcaccttataaggtgaatt 34948202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 41139085 - 41139204
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || ||||||||||| || |||| ||| | |||||||  ||||||| ||| |||||| ||||||||    
41139085 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaatcccggacacttcacttattcactttaaaa-gtgaattt 41139183  T
457 ctatccactatactacttgac 477  Q
    ||| ||||||  |||||||||    
41139184 ctagccactaggctacttgac 41139204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 45284887 - 45284811
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||  || || |||| ||||| |||||||||| || |||| ||||| ||||||||||||||    
45284887 cgtgagcttagctcagttgatagggacattgaataatttatgcaggggtcggggttcgaaccccggacaccccactt 45284811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 48447749 - 48447833
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| |||| || ||||| ||||  ||||||||||||||| |||| ||||| | ||||| |||||| |||||    
48447749 ctcgtgagcttaactcagttggtagagatatcgcattttatatgcaggggccggggttcgaaccccagacactccacttctccac 48447833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 373 - 440
Target Start/End: Original strand, 10646182 - 10646249
Alignment:
373 attggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| || ||||||||||| | |||||| |||  | ||||||||||||||||||||||||| |||||    
10646182 attggtagggatattgcatattttatgcaagggtaggggtttgaacctcggacaccccacttctccac 10646249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 444
Target Start/End: Original strand, 11808037 - 11808123
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    |||||||||||||||||||| || || || ||||  | ||||||||||| || |||| ||||| |||||||||||||||| |||||||    
11808037 cgtgagcttagctcaattggtagggacat-gcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctta 11808123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 474
Target Start/End: Complemental strand, 21461746 - 21461631
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttct 458  Q
    |||||||||||||  ||| || || | |||||||| |||||| ||| || |||| ||| |||||||| ||||||||| ||| || |||| |||||||| |    
21461746 tgagcttagctcagctggtagggacaatgcataatttatgcaagggtcggggttcgaatctcggacatcccacttattcactttaaaaaggtgaatttat 21461647  T
459 atccactatactactt 474  Q
    | |||||| |||||||    
21461646 aaccactagactactt 21461631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Complemental strand, 27510325 - 27510270
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt 413  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| ||||    
27510325 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggtt 27510270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Original strand, 36622176 - 36622231
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt 413  Q
    ||||| |||||||||||||| || ||||||||||| |||||||| |||||| ||||    
36622176 cgtgaacttagctcaattggtagggatattgcatattatatgcatgggccggggtt 36622231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 446
Target Start/End: Complemental strand, 47440849 - 47440790
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa 446  Q
    ||||||||||||||||||| || |||| |||||  ||||||||||||| ||||| |||||    
47440849 tgcataatatatgcaggggtcggggttcgaaccctggacaccccacttctccacattaaa 47440790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 455
Target Start/End: Complemental strand, 2261580 - 2261483
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||| | ||||||||| |||||| ||||||| || |||||||    
2261580 cgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccggggttcgaatcccggacacccaacttattcaccttataaggtgaatt 2261483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 412 - 477
Target Start/End: Original strand, 3948107 - 3948173
Alignment:
412 tttgaacctcggacaccccacttatccacctta-aaatgtgaatttctatccactatactacttgac 477  Q
    ||||| || |||||||| ||||||| || |||| ||||||||||||||| |||||| ||||||||||    
3948107 tttgagccccggacacctcacttattcatcttataaatgtgaatttctagccactaaactacttgac 3948173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 435
Target Start/End: Original strand, 7465465 - 7465542
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccactta 435  Q
    ||||||| ||||||| ||||||| || || |||| || |||||||||||||| |||| ||||| |||||||||||||||    
7465465 cgtgagcatagctcagttggcagagacat-gcattattatatgcaggggccggggttcgaaccccggacaccccactta 7465542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 365 - 439
Target Start/End: Original strand, 13720779 - 13720853
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||| ||||  | ||||||||||| ||||||||||||||| |||| ||||| || |||| |||||| ||||    
13720779 ttagctcagttggttgggatattgcatattatatgcaggggccggggttcgaaccccgaacactccacttctcca 13720853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 14204298 - 14204356
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||||| |||||| | |||| ||||||||||||| |||||| |||||    
14204298 gatattgcatattatatgtaggggctggggttcgaacctcggacactccacttctccac 14204356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 24880516 - 24880438
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||| ||| |||||||||| |||| |||| ||||| || |||| |||||| |||||    
24880516 agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccgaacactccacttctccac 24880438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 456
Target Start/End: Complemental strand, 27907956 - 27907894
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||||||||||| |||  ||| |||||||||||||||||| || |||| || ||||||||    
27907956 tatatgcaggggccggggtaagaatctcggacaccccacttattcatcttataaggtgaattt 27907894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 353 - 435
Target Start/End: Complemental strand, 28479401 - 28479319
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactta 435  Q
    |||| ||||| |||| |||||||| ||| ||||||||||| |||||| | | ||||  ||||||||| | |||||||||||||    
28479401 agtcacgtgaacttaactcaattgacagggatattgcatattatatgaaagagccggagtttgaaccccagacaccccactta 28479319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 31762002 - 31762056
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt 413  Q
    ||||| ||||||||||||| || |||||||||| ||||||| |||||| ||||||    
31762002 gtgagtttagctcaattggtagggatattgcatgatatatgtaggggctgtggtt 31762056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 32047115 - 32047173
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||  ||||||||||||||| |||| ||||| |||||||| ||||| |||||    
32047115 gatattgcatgttatatgcaggggccggggttcgaaccccggacacctcacttctccac 32047173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 32074463 - 32074381
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || |||||  |||  ||||||||||||| | |||| ||||| ||||||| |||||| |||||    
32074463 cgtgagcttagctcagttggtagggatatcacattttatatgcaggggctggggttcgaaccccggacactccacttctccac 32074381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 32856985 - 32856903
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||| |||||| || ||||||||||| ||||||||||||| |  ||| ||||| | ||||| |||||| |||||    
32856985 cgtgaacttagcttaattggtagggatattgcatattatatgcaggggctgaagttcgaaccccagacactccacttctccac 32856903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34267619 - 34267537
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||  |||||||||| |||||||||| || | |||| ||||| |||||||  ||||| |||||    
34267619 cgtgagcttagctcagttggtaggaatattgcatattatatgcaggagctggggttcgaaccccggacacttcacttctccac 34267537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 35683195 - 35683113
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  |||||||||||| || |||| ||||  ||||||| |||||| |||||    
35683195 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccacttctccac 35683113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #104
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 38889561 - 38889479
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| ||||||||||||| | |||| | ||| | ||||| |||||| |||||    
38889561 cgtgagcttaactcagttggtagggatattgcatattatatgcaggggctgaggttcgtaccccagacactccacttctccac 38889479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #105
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 370 - 440
Target Start/End: Complemental strand, 39956457 - 39956387
Alignment:
370 tcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| ||  |||||||||||| |||||| ||||  ||||| ||||||| |||||||||||| |||||    
39956457 tcaattggtaggaatattgcataatttatgcaagggcaatggttcgaacctctgacaccccacttctccac 39956387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #106
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 472
Target Start/End: Original strand, 42887189 - 42887266
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactac 472  Q
    ||||||||||||| | |||| ||||| ||||||||||||||||  |||||| || ||||| ||||| |||||| |||||    
42887189 tatatgcaggggctgaggttcgaaccccggacaccccacttatttaccttataaggtgaa-ttctagccactagactac 42887266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #107
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Complemental strand, 44437885 - 44437843
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| |||| ||||| ||||||||||||||||    
44437885 tatatgcaggggccggggttcgaaccccggacaccccacttat 44437843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #108
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 48288469 - 48288395
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| ||||    
48288469 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaatcccggacactccac 48288395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 15106758 - 15106677
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| | ||||| |||||| |||||    
15106758 gtgagcttaactcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccac 15106677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 479
Target Start/End: Complemental strand, 17900939 - 17900855
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacca 479  Q
    ||||||||||||||| || | ||||| ||||| |||||||||| | ||||| || ||||| ||||| ||||||  |||||||||||    
17900939 tatatgcaggggccggggctcgaaccccggactccccacttattctccttataaggtgaa-ttctagccactaggctacttgacca 17900855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #111
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 459
Target Start/End: Original strand, 19126772 - 19126836
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttcta 459  Q
    ||||| ||||||| | |||| ||||| |||||||||||||||| ||| |||||| |||||||||||    
19126772 tatatacaggggctgaggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttcta 19126836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #112
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 27425117 - 27425166
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||| ||||||||||| |||||| ||||| ||||||||| ||||    
27425117 attgcataatttatgcaggggcagtggttcgaaccccggacacccgactt 27425166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #113
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 446
Target Start/End: Complemental strand, 28914950 - 28914885
Alignment:
382 gatattgcataatatatgcagggg-ccgtggtttgaacctcggacaccccacttatccaccttaaa 446  Q
    |||| |||||| |||||||||||| ||| |||| ||||| |||||||||||||||| ||| |||||    
28914950 gataatgcatattatatgcagggggccggggttcgaaccccggacaccccacttattcactttaaa 28914885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #114
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 30644204 - 30644265
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||  ||| ||||| | |||||||||||||| ||||||| || |||||||    
30644204 tatatgcaggggccggtgttcgaaccccagacaccccacttattcaccttataaggtgaatt 30644265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #115
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 33202614 - 33202553
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||| ||||||||| |||| ||||| |||||||||||||||| || |||| || |||||||    
33202614 tatatacaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaatt 33202553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #116
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 37449570 - 37449509
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| ||  |||||||||| ||||| ||||||||| ||| |||||| |||||||    
37449570 tatatgcaggggtcggagtttgaaccttggacatcccacttattcactttaaaaagtgaatt 37449509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #117
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 45011718 - 45011657
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||| ||||  |||| |||||||||| ||||||||||| ||||||| || |||||||    
45011718 tatatgcagaggccagggttcgaacctcggagaccccacttattcaccttataaggtgaatt 45011657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #118
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 47999782 - 47999863
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||| || | |||| ||| | ||||||| |||||| ||||    
47999782 cgtgagcttagctcagttggtagggatattgcatattatatgtaggagctggggttcgaatcccggacactccacttctcca 47999863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #119
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 48433805 - 48433728
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| ||||  |||| ||||||||||||||||    
48433805 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcaaaccccggacaccccacttat 48433728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 8e-20; HSPs: 106)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 1844823 - 1844901
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||||||||||||||||||| |||||    
1844823 agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacctcggacaccccacttctccac 1844901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 459
Target Start/End: Original strand, 23405198 - 23405300
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaattt 456  Q
    ||||||||||||||| |||| || || ||||||||||||||||||||| || |||| |||||  ||||||||||||||| |||||| |||| ||||||||    
23405198 cgtgagcttagctcagttggtagggacattgcataatatatgcaggggtcggggttcgaaccctggacaccccacttattcaccttaaaaaggtgaattt 23405297  T
457 cta 459  Q
    |||    
23405298 cta 23405300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 33229001 - 33228919
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
33229001 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 33228919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 5612957 - 5613038
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| ||||||| ||||||||||| |||||||| |||||| |||| ||||| |||||||||||||| |||||    
5612957 gtgagcttagctcagttggcagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccac 5613038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 358 - 476
Target Start/End: Original strand, 29034974 - 29035092
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
29034974 cgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 29035072  T
457 ctatccactatactacttga 476  Q
    ||| ||||||  ||||||||    
29035073 ctagccactaggctacttga 29035092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 356 - 439
Target Start/End: Complemental strand, 44857304 - 44857221
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| ||||    
44857304 ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccacttctcca 44857221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3446732 - 3446814
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||||||||| |||||    
3446732 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccacttctccac 3446814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 20919612 - 20919694
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||||| ||||| ||||||| |||| ||||| |||||||||||||| |||||    
20919612 cgtgagcttagctcagttggtagggacattgcataatttatgctggggccggggttcgaaccccggacaccccacttctccac 20919694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34613981 - 34614063
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| | |||| |||||    
34613981 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactctacttctccac 34614063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40473618 - 40473536
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| ||  |||||||||  ||||||||||||| | ||||||||||||||||||||||||| |||||    
40473618 cgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggctggggtttgaacctcggacaccccacttctccac 40473536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40535517 - 40535435
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
40535517 cgtgagcttagctcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccac 40535435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 41509518 - 41509600
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
41509518 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 41509600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 1964355 - 1964436
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||| ||||||| ||||||||| || |||||||||| ||||||||||||| ||||  |||| |||||||||||||| ||||    
1964355 cgtgaacttagcttaattggcagggacattgcataatttatgcaggggccggggttcaaaccccggacaccccacttctcca 1964436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 3287123 - 3287042
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||| || |||||| |||||    
3287123 gtgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttctccac 3287042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 44666413 - 44666329
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||||||||||| ||| |||||||||||||||||||||||  || |||| ||||| ||||||  |||||| |||||    
44666413 ctcgtgagtttagctcaattgacagggatattgcataatatatgcagggatcggggttcgaaccccggacattccacttctccac 44666329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 3596255 - 3596334
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| | ||||||| || |||||||||| |||||||||| || |||| ||||| |||||||||||||| |||||    
3596255 gagcttagcttagttggcagagacattgcataatttatgcaggggtcggggttcgaaccccggacaccccacttctccac 3596334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2643699 - 2643781
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
2643699 cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 2643781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4562820 - 4562738
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
4562820 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 4562738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4878211 - 4878293
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| ||||||| ||||||| ||| |||||| |||||||  |||| ||||| |||||||||||||| |||||    
4878211 cgtgagtttagctcacttggcagggatattgtatattatatgtaggggccagggttcgaaccccggacaccccacttctccac 4878293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 5521288 - 5521206
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  || ||||||||||| ||||||||||||||| |||| |||||  |||||| |||||| |||||    
5521288 cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgaggttcgaaccctggacactccacttttccac 5521206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 15233415 - 15233465
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg 408  Q
    |||||||||||||||||||| || ||||||||||| |||||||||||||||    
15233415 cgtgagcttagctcaattggtagggatattgcatattatatgcaggggccg 15233465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17034737 - 17034819
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||||||||| |||||||||| | || |||| ||| | ||||||| |||||| |||||    
17034737 cgtgagcttagctcaattggtagggatattgcatattatatgcaggagtcggggttcgaatcccggacactccacttctccac 17034819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19281610 - 19281692
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
19281610 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac 19281692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 22653712 - 22653630
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
22653712 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 22653630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36182644 - 36182726
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
36182644 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccggacactccacttctccac 36182726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 44187702 - 44187823
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||| ||| ||||||| |||| ||||| || ||||||||||| || |||| ||||| | |||||||||||||| ||| |||||| ||||||||    
44187702 cgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaa-gtgaattt 44187800  T
457 ctatccactatactacttgacca 479  Q
     || |||||| ||||| ||||||    
44187801 ttagccactaaactacctgacca 44187823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 3037682 - 3037621
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
3037682 tatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 3037621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 419
Target Start/End: Complemental strand, 8250369 - 8250308
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| |||||    
8250369 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacc 8250308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 11050825 - 11050744
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || |||||| |||| ||||||||||||| | |||| ||||  |||||||||||||| ||||    
11050825 cgtgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaactccggacaccccacttctcca 11050744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 430
Target Start/End: Original strand, 5474908 - 5474980
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccc 430  Q
    ||||||||||||||| ||||||| ||||||||||| |||| ||||| |||| |||| ||||  ||||||||||    
5474908 cgtgagcttagctcagttggcagggatattgcatattatacgcaggagccggggttcgaactccggacacccc 5474980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 13242801 - 13242717
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||| ||| |||  || ||||||||||||| |||||||||| || |||| |||||||||||||| ||||| |||||    
13242801 ctcgtgaacttagatcagttgatagagatattgcataatttatgcaggggtcggggttcgaacctcggacacctcacttctccac 13242717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 28194636 - 28194716
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||  || ||||||||||| ||||||||||||| |  ||| ||||| |||||||||||||| |||||    
28194636 tgagcttagctcagttgctagggatattgcatattatatgcaggggctggagttcgaaccccggacaccccacttctccac 28194716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 31223624 - 31223704
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| ||| |||| || ||||||||||| ||||||||||||| | |||||||||| | ||||| |||||| |||||    
31223624 tgagcttagttcagttggtagggatattgcatattatatgcaggggctggggtttgaaccccagacactccacttctccac 31223704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 395 - 455
Target Start/End: Complemental strand, 34018129 - 34018069
Alignment:
395 atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| | |||| |||||||||||||||||||||| ||||||| || |||||||    
34018129 atatgcaggggctggggttcgaacctcggacaccccacttattcaccttataaggtgaatt 34018069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Original strand, 35367415 - 35367495
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||  |  ||||||||||| ||||| || |||||| |||| ||||| ||||||||||||||||||||    
35367415 tgagcttagctcagttgataatgatattgcatattatatacaagggccgaggttcgaaccccggacaccccacttatccac 35367495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 36665465 - 36665536
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||||| |||| |||||||||||||||||||||| ||  ||| || ||||| ||||||||||||    
36665465 tatatgcaggggccggggttcgaacctcggacaccccacttattcattttataaggtgaa-ttctatccacta 36665536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 356 - 439
Target Start/End: Complemental strand, 28195204 - 28195121
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||||| |||| || ||||||||||| |||||||| |||| | ||||  |||| |||| ||||||||| ||||    
28195204 ctcgtgagcttagctcagttggtagggatattgcatattatatgcaagggcaggggttctaaccccggataccccacttctcca 28195121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 30390430 - 30390355
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||||| |||| |||||    
30390430 ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccctacttctccac 30390355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Complemental strand, 580843 - 580793
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| |||||||    
580843 tatatgcaggggccggggttcgaaccccggacaccccacttattcacctta 580793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 1071472 - 1071554
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||| ||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
1071472 cgtgagcttagctcagttggtatggatattgtatattatatgcaggagccggggttcgaaccccggacactccacttctccac 1071554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 2304288 - 2304409
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||||||||||| ||||||| || | || || || ||||| ||||| || |||| ||||| ||||||||||||||||  || |||||| ||||||||    
2304288 cgtgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatttactttaaaa-gtgaattt 2304386  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
2304387 ctaaccactaggctacctgacca 2304409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3438950 - 3439032
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
3438950 cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 3439032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 4183178 - 4183260
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| |||||| |||||    
4183178 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccgaacactccacttctccac 4183260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 6331564 - 6331645
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
6331564 cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccg-ggttcgaaccccggacactccacttctccac 6331645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 444
Target Start/End: Original strand, 17154684 - 17154734
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctta 444  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| |||||||    
17154684 tatatgcaggggccggggttcgaaccccggacaccccacttattcacctta 17154734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 18278485 - 18278403
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| |||||    
18278485 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac 18278403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 20296420 - 20296502
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  |  ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
20296420 cgtgagcttagctcagttgataaggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 20296502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25857363 - 25857281
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||  ||||||| |||||| |||||    
25857363 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacaccggacactccacttctccac 25857281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 404
Target Start/End: Complemental strand, 27913537 - 27913491
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggg 404  Q
    |||||||||||||||||||| || ||||||||||| |||||||||||    
27913537 cgtgagcttagctcaattggtagggatattgcatattatatgcaggg 27913491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 394 - 440
Target Start/End: Original strand, 32221005 - 32221051
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |||||||||||||||||||| |||||    
32221005 tatatgcaggggccggggttcgaacctcggacaccccacttttccac 32221051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 36005444 - 36005526
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| || ||||||||| || ||||||||||| |||||||||| |||| |||| ||||| | ||||| |||||| |||||    
36005444 cgtgagcgtaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccacttctccac 36005526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 38400312 - 38400362
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg 408  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||||||    
38400312 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccg 38400362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 44186469 - 44186527
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||| ||||||||| ||| |||||| |||||||||||||||||||| |||||    
44186469 gatattacatattatatgcagcggctgtggttcgaacctcggacaccccacttctccac 44186527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 3179359 - 3179420
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||||| |||||||||||||| ||||||| || |||||||    
3179359 tatatgcaggggtcgaggttcgaacctcagacaccccacttattcaccttataaggtgaatt 3179420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 8234852 - 8234791
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||| |||||||| |||| ||||| |||||||||||||||| ||||||| || |||||||    
8234852 tatatgtaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 8234791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 11133111 - 11133172
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| |||||||||||||||| ||||||| || |||||||    
11133111 tatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 11133172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 405
Target Start/End: Original strand, 15764930 - 15764979
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcagggg 405  Q
    ||||||||||||||||| |||| || ||||||||||| ||||||||||||    
15764930 ctcgtgagcttagctcagttggtagggatattgcatattatatgcagggg 15764979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 30474255 - 30474194
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| | |||||||||||||| ||||||| || |||||||    
30474255 tatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaatt 30474194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 361 - 434
Target Start/End: Complemental strand, 32190067 - 32189994
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||| ||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||| |||||    
32190067 gagcttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcactt 32189994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 462
Target Start/End: Complemental strand, 32527166 - 32527070
Alignment:
366 tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatcc 462  Q
    ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| | |||| ||||||||| ||| |||||| ||||||||||||||    
32527166 tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttattcactttaaaa-gtgaatttctatcc 32527070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 387 - 436
Target Start/End: Complemental strand, 33482709 - 33482660
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    |||| ||||||||||||| |||||||| ||||||| ||||||||||||||    
33482709 tgcacaatatatgcagggaccgtggttcgaacctcagacaccccacttat 33482660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 359 - 432
Target Start/End: Complemental strand, 38179312 - 38179239
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||| |||||||| |||| || ||||||||||  ||||||||||||| | |||| ||||||||||||| ||||    
38179312 gtgagtttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaacctcggacactccac 38179239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 44721764 - 44721703
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||||||||||||||| |||| ||||||| || |||||||    
44721764 tatatgcaggggtcggggttcgaacctcggacaccccatttattcaccttataaggtgaatt 44721703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 44948598 - 44948659
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||| ||| |||| |||||    
44948598 cgtgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaacc 44948659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 427
Target Start/End: Complemental strand, 6636034 - 6635966
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    |||||||||||||| |||| || ||||||||||| ||||||||||| | | |||| ||||| |||||||    
6636034 gtgagcttagctcagttggtagggatattgcatattatatgcagggacgggggttcgaaccccggacac 6635966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 353 - 472
Target Start/End: Complemental strand, 22297553 - 22297435
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||| ||||||| |||| || || | ||||| || |||||||||||| | |||| ||||| ||||||||||| |||| ||||||| |||||     
22297553 agtctcgtgagcatagctcagttggtag-gacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttattcaccttataatgtt 22297455  T
452 aatttctatccactatactac 472  Q
    || ||||| |||||| |||||    
22297454 aa-ttctagccactaaactac 22297435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 433
Target Start/End: Original strand, 24202148 - 24202224
Alignment:
358 cgtgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact 433  Q
    ||||||||||||||| |||| | | |||| ||||| || ||||||||||||| |||| ||||| |||||||||||||    
24202148 cgtgagcttagctcacttggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacaccccact 24202224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 362 - 406
Target Start/End: Complemental strand, 24581528 - 24581484
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggc 406  Q
    |||||| |||| ||||||| |||||||||||||||||||||||||    
24581528 agcttaactcagttggcagggatattgcataatatatgcaggggc 24581484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 34034349 - 34034467
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | | ||| || |||||||||  ||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
34034349 cgtgagcatagctcagttggcagggacaatacattattatatgcagga-ccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 34034446  T
457 ctatccactatactacttgac 477  Q
    ||| |||||| ||||| ||||    
34034447 ctagccactagactacctgac 34034467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 40688709 - 40688625
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||||| |||| || ||||||||||  ||||||||||||||  |||| ||||| ||||||| | |||| |||||    
40688709 ctcgtgatcttagctcagttggtagagatattgcattttatatgcaggggccagggttcgaaccccggacactctacttctccac 40688625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 43870988 - 43871059
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    |||||||||| |||| |||| ||| | |||||||||||||||| ||| |||||| ||||||||||| ||||||    
43870988 tatatgcaggagccggggttcgaatcccggacaccccacttattcactttaaaa-gtgaatttctagccacta 43871059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 440
Target Start/End: Original strand, 15939294 - 15939373
Alignment:
361 gagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| |||||||||||| || |||||||||||||||||| ||    |||| ||||| || ||||||||||| |||||    
15939294 gagcttaactcaattggcagagacattgcataatatatgcagaggttagggttcgaaccccgaacaccccacttctccac 15939373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 17777223 - 17777149
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| | ||||||| ||||||| ||| |||||||||||| || |||| ||||| |||||||||||||| |||||    
17777223 ttagcttagttggcag-gatattgtatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac 17777149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 436
Target Start/End: Original strand, 20435779 - 20435858
Alignment:
358 cgtgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| |||| | | ||||||||||| | |||||| || ||| |||| |||||||||||| |||||||||    
20435779 cgtgagcttagctcacttggtaagggatattgcatattttatgcaaggcccggggttcgaacctcggacatcccacttat 20435858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 23984292 - 23984209
Alignment:
358 cgtgagcttagctcaattggcagcgatat-tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || || |  |||||  ||||||||||||||  |||| ||||| |||||||||||||| |||||    
23984292 cgtgagcttagctcaattggtagggacaaatgcattttatatgcaggggccagggttcgaaccccggacaccccacttctccac 23984209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 383 - 434
Target Start/End: Complemental strand, 37512419 - 37512368
Alignment:
383 atattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||||| |||| || ||||| |||| ||||||||||||||||||||    
37512419 atattgcataatttatgtagaggccggggttcgaacctcggacaccccactt 37512368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 440
Target Start/End: Original strand, 40864400 - 40864483
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||| |||| ||  |||||||||  ||||||||||||||| |||| ||||  ||||||| ||| || |||||    
40864400 tcgtgagcttagctcagttggtaggaatattgcattttatatgcaggggccggggttcgaacaccggacactccaattctccac 40864483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 44558031 - 44558086
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||||||||||| | |||| ||||| |||||||||||||| |||||    
44558031 attgcataatttatgcaggggctggggttcgaaccccggacaccccacttctccac 44558086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 365 - 439
Target Start/End: Original strand, 1500970 - 1501044
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| ||||    
1500970 ttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctcca 1501044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 2145803 - 2145721
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||| ||| |||| || || |||||||||| ||||||||||| | |||||||| | | |||||||||||| |||||    
2145803 cgtgaacttagttcagttggtagggacattgcataatttatgcaggggcagaggtttgaatccctgacaccccacttctccac 2145721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3301813 - 3301895
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  ||||| |||||| || |||| ||||| || |||| |||||| |||||    
3301813 cgtgagcttagctcatttggtagggatattgcattttatatacaggggtcggggttcgaaccccgaacactccacttctccac 3301895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9330569 - 9330487
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||  || ||||||||||| ||||||||||||| | |||  ||||  ||||||| ||||||||||||    
9330569 cgtgagcttaactcagttgatagagatattgcatattatatgcaggggctgaggtgcgaactccggacactccacttatccac 9330487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 11950064 - 11949982
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || || ||| || ||| |||||||||| || |||| ||||| |||||||||||||| |||||    
11950064 cgtgagcttagctaagttggtagagaaattacacaatttatgcaggggacgaggttcgaaccccggacaccccacttctccac 11949982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17487706 - 17487788
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || ||||||||||| ||||||||| ||| | |||| ||||| |||||||  ||||| |||||    
17487706 cgtgaacttagctcagttggtagggatattgcatattatatgcagtggctggggttcgaaccccggacacttcacttctccac 17487788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 18255656 - 18255698
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| | || ||||||||||||||||||||||    
18255656 tatatgcaggggccgagtttcgaacctcggacaccccacttat 18255698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19684075 - 19684156
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| | ||||| |||||| |||||    
19684075 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacc-ccgacactccacttctccac 19684156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 27497596 - 27497514
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||  |||||||| |||| |  |||||||||||  ||||||||||| |||||    
27497596 cgtgagcatagctcagttggtagggatattgcatgttatatgcaagggctggagtttgaacctcaaacaccccacttctccac 27497514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33262444 - 33262526
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| ||||||||  ||| || ||||| ||||  |||||||||||| || |||| ||||||||||||| |||||| |||||    
33262444 cgtgagtttagctcagctggtagggatatcgcattttatatgcaggggtcggggttcgaacctcggacactccacttctccac 33262526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Original strand, 34355727 - 34355805
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||| |||||| |||| || ||||||| ||| ||||||||||||||| |||| ||||| | ||||| |||||| |||||    
34355727 agctcagctcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccagacactccacttctccac 34355805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 39408758 - 39408676
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||| | |||| |||| ||||| | ||||| |||||| |||||    
39408758 cgtgagcttaactcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccagacactccacttctccac 39408676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 44822425 - 44822507
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||  |||||||||| |||| |||| ||||| | ||||| |||||| |||||    
44822425 cgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccggggttcgaaccccagacactccacttctccac 44822507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 9796932 - 9796993
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| |||||||||||||||| || |||| || |||||||    
9796932 tatatgcaggggtcggggttcgaaccccggacaccccacttattcatcttataaggtgaatt 9796993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 436
Target Start/End: Original strand, 10058871 - 10058948
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||| ||||||||| || || | |||||||||||||||  || || |||||||||| |||||| | |||||||    
10058871 gtgagcttaactcaattggtagagacaatgcataatatatgcaaaggtcggggtttgaaccccggacaactcacttat 10058948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 10262774 - 10262835
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| | |||||||||||||| ||||||| || |||||||    
10262774 tatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataaagtgaatt 10262835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 423 - 476
Target Start/End: Complemental strand, 12846828 - 12846775
Alignment:
423 gacaccccacttatccaccttaaaatgtgaatttctatccactatactacttga 476  Q
    ||||||||| ||| ||||||||||| ||||||||||| |||||| |||| ||||    
12846828 gacaccccatttagccaccttaaaaagtgaatttctagccactagactatttga 12846775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 15485664 - 15485733
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    ||||||||||||||| |||| |  ||||||||||| ||||||| || || | ||||||||||| ||||||    
15485664 cgtgagcttagctcagttggtaaggatattgcatattatatgctggagcaggggtttgaaccttggacac 15485733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 15625385 - 15625261
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgca--ggggccgtggtttgaacctcggacaccccacttatccaccttaaaa-tgtgaat 454  Q
    |||||| ||||||||||||  || || ||||||||||||||  |  ||||||| |||| ||||  |  |||| |||||||| |||||||||  |||||||    
15625385 cgtgagtttagctcaattgatagggacattgcataatatatatataggggccggggttcgaactccatacactccacttattcaccttaaatgtgtgaat 15625286  T
455 ttctatccactatactacttgacca 479  Q
    ||||| ||||||  |||||||||||    
15625285 ttctagccactaggctacttgacca 15625261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 17239936 - 17239997
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || | || |||||||||||||||||||||| || |||| || |||||||    
17239936 tatatgcaggggtcgggattcgaacctcggacaccccacttattcatcttataaggtgaatt 17239997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 403
Target Start/End: Original strand, 18694787 - 18694832
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcagg 403  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||    
18694787 cgtgagcttagctcagttggtagggatattgcatattatatgcagg 18694832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 23919544 - 23919463
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || || ||||||||||||||| ||||| || |||| ||| | | ||||||||| || |||||    
23919544 gtgagcttagctcagttggtagggacattgcataatatatggaggggtcggggttcgaatcccagacaccccatttctccac 23919463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 451
Target Start/End: Original strand, 26336706 - 26336775
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||| |||||| ||||| || |||| |||||||| |||| |||||| | ||| ||||||||||    
26336706 gatattgcatattatatgaaggggtcggggttcgaacctcgaacactccacttcttcacattaaaatgtg 26336775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 27297177 - 27297258
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||| | |||||||| || | | || ||||| ||||||| |||||| ||||    
27297177 cgtgagcttagctcagttggtagggatattgcatattgtatgcaggagctgggattcgaaccccggacactccacttctcca 27297258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 28153209 - 28153128
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| |||| |||| || ||||||||||  ||||||||||   || |||| ||||| |||||||||||||| |||||    
28153209 gtgagcttaactcagttggtagggatattgcatgttatatgcaggattcggggttcgaaccccggacaccccacttctccac 28153128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 33001613 - 33001552
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||| |||||| |||||||| | |||||||||||||||| || |||| || |||||||    
33001613 tatatgcaagggccggggtttgaatcccggacaccccacttattcatcttataaggtgaatt 33001552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 36386173 - 36386121
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||||||| || |||||||| |||||||||||||||||| ||| ||||||    
36386173 tatatgcaggggtcg-ggtttgaatctcggacaccccacttattcactttaaaa 36386121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 37352560 - 37352479
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||| |||| |||| || ||||||||||| |||||||||||||||  ||||||||  || |||||||| || |||||    
37352560 gtgagtttaactcagttggtagggatattgcatattatatgcaggggccgaagtttgaactccgaacaccccatttctccac 37352479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 51; Significance: 8e-20; HSPs: 158)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 21265658 - 21265740
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
21265658 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 21265740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33207207 - 33207289
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| |||||||||||||| |||||    
33207207 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccacttctccac 33207289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 22563388 - 22563470
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
22563388 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccac 22563470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 36666644 - 36666562
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||||| ||||||||||||| |||| ||||| |||||||||||||| |||||    
36666644 cgtgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccacttctccac 36666562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42490478 - 42490396
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||||| |||||||||||||| |||||    
42490478 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttctccac 42490396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 47469141 - 47469059
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| || |||||||||| ||||||||||| | |||| ||||| |||||||||||||| |||||    
47469141 cgtgagcttagctcagttggcagggacattgcataatttatgcaggggctgaggttcgaaccccggacaccccacttctccac 47469059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 362 - 479
Target Start/End: Complemental strand, 4069702 - 4069586
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatc 461  Q
    ||||||||||| |||| |  |||||||||| |||||||||||||||| |||||||||| ||||  | |||||||| |||||||| | ||||| ||||| |    
4069702 agcttagctcagttggtacagatattgcattatatatgcaggggccggggtttgaaccccggattctccacttattcaccttaagaggtgaa-ttctacc 4069604  T
462 cactatactacttgacca 479  Q
    |||||  |||||||||||    
4069603 cactaggctacttgacca 4069586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 24874973 - 24875054
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||||| |||||| |||| | |||| |||||||||||||||||||| ||||    
24874973 cgtgagcttagctcagttggtagggatattgcataatttatgcatgggcaggggttcgaacctcggacaccccacttctcca 24875054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 5190847 - 5190767
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||| || ||||| ||||| |||||||||||| || |||| ||||| |||||||||||||| |||||    
5190847 tgagcttagctcaattggtagggatatcgcatattatatgcaggggtcgaggttcgaaccccggacaccccacttctccac 5190767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 359 - 466
Target Start/End: Complemental strand, 13870177 - 13870070
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc 457  Q
    |||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||||||| | |||||||||||||||| ||| |||||| |||||||||    
13870177 gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttattcactttaaaa-gtgaatttc 13870079  T
458 tatccacta 466  Q
    || ||||||    
13870078 tagccacta 13870070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 356 - 451
Target Start/End: Complemental strand, 27178778 - 27178683
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||||||||| ||||||||| |  ||||||| ||| |||||||||||||||   || ||| |||||||||||||||| ||||| ||||||||||    
27178778 ctcgtgagcttaactcaattggtaaggatattgtatattatatgcaggggccggaattcgaatctcggacaccccacttctccacattaaaatgtg 27178683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 1570260 - 1570178
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
1570260 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 1570178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6438132 - 6438050
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
6438132 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 6438050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6893305 - 6893223
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
6893305 cgtgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccacttttccac 6893223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7166295 - 7166213
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| ||||||| |||||| |||||    
7166295 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccacttctccac 7166213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 15819669 - 15819587
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
15819669 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 15819587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 16343030 - 16343112
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
16343030 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 16343112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 366 - 479
Target Start/End: Original strand, 17350067 - 17350180
Alignment:
366 tagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccac 464  Q
    ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||||| ||||    
17350067 tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaa-gtgaatttctagccac 17350165  T
465 tatactacttgacca 479  Q
    ||  ||| |||||||    
17350166 taggctatttgacca 17350180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 18551701 - 18551619
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| |  ||||||||||| ||||||||||||||| |||||||||| || |||| |||||| |||||    
18551701 cgtgagcttagctcagttggtatggatattgcatattatatgcaggggccggggtttgaaccccgaacactccacttctccac 18551619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 387 - 477
Target Start/End: Original strand, 32635168 - 32635258
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgac 477  Q
    ||||| |||||||||||||  | |||| ||||| |||||||||||||||| |||||||| | ||||||||||| ||||||  |||||||||    
32635168 tgcattatatatgcaggggttggggttcgaaccccggacaccccacttattcaccttaagaggtgaatttctagccactaggctacttgac 32635258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 34058216 - 34058298
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
34058216 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacactccacttctccac 34058298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 356 - 434
Target Start/End: Complemental strand, 37662627 - 37662549
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||||| |||| || ||||||||||| |||||||||||| || |||  ||||| ||||||||||||||    
37662627 ctcgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggtacgaaccccggacaccccactt 37662549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 459
Target Start/End: Original strand, 39238714 - 39238815
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||| ||| |||||| ||||||||    
39238714 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 39238812  T
457 cta 459  Q
    |||    
39238813 cta 39238815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 40678821 - 40678942
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| || || |||||||||||||||| ||| |||||| ||||||||    
40678821 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattcactttaaaa-gtgaattt 40678919  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
40678920 ctagccactaggctacctgacca 40678942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 42550077 - 42549995
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||| || || ||||||||||| || |||||||||||| ||||| |||||| ||| |||||||| |||||    
42550077 cgtgagcttagctcaatcggtagggatattgcatattacatgcaggggccgaggttttaacctcagacgccccacttctccac 42549995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 44732635 - 44732717
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||| |||||| |||| ||||| |||||||||||||| |||||    
44732635 cgtgagcttaactcagttggtagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccacttctccac 44732717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 47763482 - 47763361
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || ||||||||||||||  ||| |||||||||||| ||||||||| ||| |||||| ||||||||    
47763482 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttattcactttaaaa-gtgaattt 47763384  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  |||| ||||||    
47763383 ctagccactaggctacctgacca 47763361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 50899578 - 50899496
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
50899578 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 50899496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 46965742 - 46965823
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| ||||    
46965742 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctcca 46965823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 382 - 446
Target Start/End: Complemental strand, 42946539 - 42946475
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa 446  Q
    |||| |||||| ||||||||||||| | |||||||||| |||||||||||||||| |||||||||    
42946539 gataatgcatattatatgcaggggctggggtttgaaccccggacaccccacttattcaccttaaa 42946475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 358 - 479
Target Start/End: Complemental strand, 52426981 - 52426859
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa--atgtgaatt 455  Q
    ||||||||||||||| |||  || ||||||||||| |||||||||||||||||||| ||||  | ||||||||| || ||||| || ||  ||||| | |    
52426981 cgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgtggttcgaactccagacaccccatttctccacatttaatgatgtg-agt 52426883  T
456 tctatccactatactacttgacca 479  Q
    |||| |||||| ||||||||||||    
52426882 tctagccactagactacttgacca 52426859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 353 - 479
Target Start/End: Original strand, 21884569 - 21884694
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||| ||||||| |||||||||||| || || | ||||| || |||||||||||||| |||| ||||| | |||||||||||||| ||||||| || |||    
21884569 agtcccgtgagcatagctcaattggtag-gacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtg 21884667  T
452 aatttctatccactatactacttgacca 479  Q
    || ||||| |||||| ||||| ||||||    
21884668 aa-ttctaaccactagactacatgacca 21884694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 29491468 - 29491588
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || ||||||||||| || |||| ||||| |||||||||||||||| ||| |||||  ||||||||    
29491468 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaa--gtgaattt 29491565  T
457 ctatccactatactacttgacca 479  Q
    ||| ||||||  ||| |||||||    
29491566 ctagccactaggctatttgacca 29491588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 387 - 486
Target Start/End: Original strand, 32660858 - 32660957
Alignment:
387 tgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgaccacagaaaa 486  Q
    ||||| |||||||||||||| | ||||  |||| |||||||||||||| | |||||||| | ||||||||||| ||||||  ||||||||| ||| ||||    
32660858 tgcattatatatgcaggggctggggttcaaaccccggacaccccactttttcaccttaagaggtgaatttctagccactaggctacttgacaacaaaaaa 32660957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2277756 - 2277838
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||| || |||||| |||||    
2277756 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggagactccacttctccac 2277838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 2754362 - 2754444
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || ||||||||||| ||||||| ||||||| |||| ||||| ||||||||| |||| |||||    
2754362 cgtgagcttagcttagttggtagggatattgcatattatatgccggggccggggttcgaaccccggacaccctacttctccac 2754444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 7180682 - 7180600
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| ||  |||||||||| |||||||||||||||  ||| ||||| |||||||||||||| |||||    
7180682 cgtgaggttagctcagttggtaggaatattgcatattatatgcaggggccggagttcgaaccccggacaccccacttctccac 7180600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 8780794 - 8780852
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||||||||||||||| ||||  ||||||||||||||||||| |||||    
8780794 gatattgcatattatatgcaggggccgaggttcaaacctcggacaccccacttctccac 8780852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 8984573 - 8984492
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| ||||||| ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
8984573 cgtgagcttaactcagttggcagggatattgcatattatatgcaggagccggggttcgaacc-cggacactccacttctccac 8984492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11215003 - 11215085
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||||    
11215003 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacactccacttctccac 11215085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11333666 - 11333748
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || || |||||||||| |||||||||||||  ||| ||||| |||||||||||||| |||||    
11333666 cgtgaacttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccac 11333748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11491687 - 11491769
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||| || || |||||||||| |||||||||||||  ||| ||||| |||||||||||||| |||||    
11491687 cgtgaacttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccacttctccac 11491769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 359 - 479
Target Start/End: Complemental strand, 13538513 - 13538391
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac-cttaaaatgtg-aattt 456  Q
    |||| ||||| ||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| |||||| |||||  || || ||||  | ||    
13538513 gtgaacttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttctccacaatttaattgtgtgagtt 13538414  T
457 ctatccactatactacttgacca 479  Q
    ||| |||||||||||||||||||    
13538413 ctagccactatactacttgacca 13538391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 19011357 - 19011439
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||||||||| ||||||||||||| | |||| ||||| | || || |||||| |||||    
19011357 cgtgagcttagctcaattggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccacttctccac 19011439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 19564220 - 19564139
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| ||||||  || |||||||||| ||||||||| ||| |||| |||||||||||||||||||| |||||    
19564220 cgtgagtttagctcagttggcaaggacattgcataatttatgcaggg-ccggggttcgaacctcggacaccccacttctccac 19564139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 479
Target Start/End: Original strand, 25819183 - 25819304
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || ||||| ||| |||| |||| ||||| |||| ||||||||||| ||| |||||| ||||||||    
25819183 cgtgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttattcactttaaaa-gtgaattt 25819281  T
457 ctatccactatactacttgacca 479  Q
    ||| |||||| ||||| ||||||    
25819282 ctagccactagactacctgacca 25819304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 25999852 - 25999934
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
25999852 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac 25999934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 32594253 - 32594335
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
32594253 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccacttctccac 32594335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33254730 - 33254812
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
33254730 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccac 33254812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 33274902 - 33274984
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| ||||||| |||||| |||||    
33274902 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccacttctccac 33274984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45333779 - 45333698
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| ||||||| |||||||||| |||||||||||||| | |||| ||||| | ||||| |||||| |||||    
45333779 cgtgagcttagctcagttggcagggatattgcat-atatatgcaggggctggggttcgaaccccagacactccacttctccac 45333698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 48638534 - 48638616
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||  ||||||||||||| | |||| ||||| | |||||||||||| |||||    
48638534 cgtgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccacttctccac 48638616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 4354165 - 4354104
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| |||| ||||||||||||||||| ||||||| || |||||||    
4354165 tatatgcaggggccggggttcgaacttcggacaccccacttattcaccttataaagtgaatt 4354104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 23991331 - 23991250
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||  |||| ||||||| || |||||||||| ||||||||||||| |||| |||||  ||||||||||||| |||||    
23991331 gtgagcttgactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccctggacaccccacttctccac 23991250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 39433393 - 39433454
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||  ||| |||||||||||||||||||||| ||||||| || |||||||    
39433393 tatatgcaggggccgatgttcgaacctcggacaccccacttattcaccttataaggtgaatt 39433454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 393 - 478
Target Start/End: Complemental strand, 50859428 - 50859344
Alignment:
393 atatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccactatactacttgacc 478  Q
    |||||||||||||||| ||||  |||| |||||||||||| ||| |||||||||| ||||| ||||| ||||||  ||||||||||    
50859428 atatatgcaggggccggggttcaaaccccggacaccccacatattcaccttaaaaggtgaa-ttctagccactaggctacttgacc 50859344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 358 - 437
Target Start/End: Complemental strand, 2052779 - 2052699
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatc 437  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||||||||||||||    
2052779 cgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttatc 2052699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 6463102 - 6463022
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| |||| || ||||||| ||  ||||||||||||||| |||| ||||| ||||||| |||||| |||||    
6463102 tgagcttagctcagttggtagggatattgtattttatatgcaggggccggggttcgaaccccggacactccacttctccac 6463022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 390 - 446
Target Start/End: Complemental strand, 10052507 - 10052451
Alignment:
390 ataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaa 446  Q
    ||||||||||||||||||| |||| ||||| |||||||||||||| ||||| |||||    
10052507 ataatatatgcaggggccgaggttcgaaccccggacaccccacttctccacattaaa 10052451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 364 - 440
Target Start/End: Complemental strand, 19063395 - 19063319
Alignment:
364 cttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| || | || ||||||||||| ||||||||||||||| |||| | ||| |||||||||||||| |||||    
19063395 cttagctcagttagtagagatattgcatattatatgcaggggccggggttcgtaccccggacaccccacttctccac 19063319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Complemental strand, 19976612 - 19976541
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||||| |||| ||||| |||||||||||| ||| ||| |||||| ||||||||||| ||||||    
19976612 tatatgcaggggccggggttcgaaccccggacaccccacatattcactttaaaa-gtgaatttctagccacta 19976541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 440
Target Start/End: Complemental strand, 31124704 - 31124624
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| ||||||  || |||||||||| ||||||||||||| |||| ||||  |||| ||||||||| |||||    
31124704 tgagcttagctcagttggcaaggacattgcataatttatgcaggggccggggttcgaactccggataccccacttctccac 31124624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 359 - 439
Target Start/End: Complemental strand, 34562854 - 34562774
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||||||| |||| |||| || |||||| |||||| ||| ||||||||| |||| ||||| |||||||||||||| ||||    
34562854 gtgagcttaactcagttggtagggatattacataatttatacaggggccgaggttcgaaccccggacaccccacttctcca 34562774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 366 - 434
Target Start/End: Complemental strand, 47930731 - 47930663
Alignment:
366 tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||| |||| || ||||||||||| ||||||||||||| | |||| |||||||||| |||||||||    
47930731 tagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcggataccccactt 47930663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 451
Target Start/End: Original strand, 10632703 - 10632790
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggaca-ccccacttatccaccttaaaatgtg 451  Q
    |||||||||||||| | || |||||||||| |||||||||| || |||| ||||| |||||| |||||||| ||||| || |||||||    
10632703 ttagctcaattggcggagacattgcataatttatgcaggggtcggggttcgaaccccggacacccccacttctccacatttaaatgtg 10632790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40519612 - 40519529
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggcc-gtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| ||| | |||| ||||| ||||||| |||||| |||||    
40519612 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggggttcgaaccccggacactccacttctccac 40519529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4482666 - 4482584
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| ||||  ||| ||||| |||| || |||||| |||||    
4482666 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccac 4482584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4553614 - 4553532
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| ||  |||||||||| ||||||||||||| | |||| ||| |||||||||| ||||| |||||    
4553614 cgtgagcttaactcagttggtagaaatattgcatattatatgcaggggctgaggttcgaatctcggacacctcacttctccac 4553532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 7191034 - 7191116
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||| ||||||||| |||  || ||||||||||| ||||||||||||| | |||| ||||| |||||||| ||||| |||||    
7191034 cgtgaccttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaaccccggacacctcacttctccac 7191116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 353 - 443
Target Start/End: Complemental strand, 7573768 - 7573678
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||||| |||||||| |||||||| |||  ||||||||||||||||||||||  |  || | ||| | |||||||||||||||||| ||||    
7573768 agtctcatgagcttaactcaattgacaggaatattgcataatatatgcagggatcagggatcgaatcccggacaccccacttatcctcctt 7573678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8865856 - 8865938
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || | || |||||  |||||| |||||| |||||    
8865856 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaaccctggacactccacttctccac 8865938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 9866252 - 9866170
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| ||| | || |||| |||||| |||||    
9866252 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccgaacactccacttttccac 9866170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 11860044 - 11860126
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||||||  | |||||||||| |||  ||||| || |||| ||||| |||||||||||||| |||||    
11860044 cgtgagcttagctcagttggcagaaacattgcataatttatataggggtcggggttcgaaccccggacaccccacttctccac 11860126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 13773170 - 13773252
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||| | ||||||| |||||| |||||    
13773170 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccacttctccac 13773252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 16526245 - 16526163
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||| || ||||||||||| |||||||||| |||   ||| ||||| || |||| |||||| |||||    
16526245 cgtgagcttagctcaattggtagggatattgcatattatatgcaggagcctgtgttcgaaccccgtacactccacttctccac 16526163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 16997327 - 16997245
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || | |||||| | ||||||||||||| |||| ||||| |||||||| ||||| |||||    
16997327 cgtgagcttagctcagttggtagagacaatgcatattttatgcaggggccgaggttcgaaccccggacacctcacttctccac 16997245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 18467266 - 18467184
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||| |||||    
18467266 cgtgagcatagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccacttctccac 18467184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 18534003 - 18534085
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| ||| | || |||| ||||| ||||||| |||||| |||||    
18534003 cgtgagcttagctcagttggtagagatattgcatattatatgtaggagtcggggttcgaaccccggacactccacttctccac 18534085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 356 - 434
Target Start/End: Complemental strand, 18607879 - 18607801
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| | |||| || || |||||||||| ||||||||||| | |||| ||||| || |||||||||||    
18607879 ctcgtgagcttagctgagttggtagggacattgcataatttatgcaggggctggggttcgaaccccgaacaccccactt 18607801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 35605691 - 35605609
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||||| || |||| |||||    ||||||||||| |||||    
35605691 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctaaacaccccacttctccac 35605609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 42054335 - 42054417
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||| |||||||| |||| |||||  |||||  |||||| |||||    
42054335 cgtgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccctggacattccacttctccac 42054417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 43021690 - 43021608
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||| | |||| || || | |||||| | |||||||||| || |||| |||||||||||||||||||| |||||    
43021690 cgtgagcttagcttagttggtagggacaatgcatattttatgcaggggtcggggttcgaacctcggacaccccacttctccac 43021608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 43884796 - 43884878
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||  |||||| |||||| |||||    
43884796 cgtgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccac 43884878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 3269621 - 3269682
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| |||||    
3269621 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc 3269682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 11405491 - 11405552
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| |||||||||||||||| ||||||| || |||||||    
11405491 tatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 11405552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 382 - 443
Target Start/End: Original strand, 19424069 - 19424130
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||| |||||| |||||||||||| || |||| ||||| |||||||||||||||| ||||||    
19424069 gataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt 19424130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 21401476 - 21401419
Alignment:
383 atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||||||||||||||| |||| |||||||| ||||| ||||| |||||    
21401476 atattgcatattatatgcaggggccgcggttcgaacctcgaacaccacacttctccac 21401419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 24134719 - 24134642
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| ||||||||||||||||    
24134719 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 24134642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 26550496 - 26550565
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacac 427  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||| ||||| |||||||    
26550496 cgtgagcttaactcagttggtagggatattgcatactatatgcaggagccggggttcgaaccccggacac 26550565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 370 - 451
Target Start/End: Complemental strand, 26909926 - 26909845
Alignment:
370 tcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||| || |||||||||| ||||||| ||| | |||| |||||  ||||||||||||| ||||| || |||||||    
26909926 tcaattggcagggacattgcataatttatgcagaggcgggggttcgaaccctggacaccccacttctccacatttaaatgtg 26909845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 30734493 - 30734436
Alignment:
383 atattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||||||||||| |  |||||||||||||||||| |||||| |||||    
30734493 atattgcatattatatgcaggggtccgggtttgaacctcggacactccacttctccac 30734436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 386 - 451
Target Start/End: Original strand, 35068717 - 35068782
Alignment:
386 ttgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||| |||||| |||||||| |||| ||||| |||||||||||||| ||||| ||| ||||||    
35068717 ttgcatattatatggaggggccggggttcgaaccccggacaccccacttctccacattagaatgtg 35068782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 366 - 451
Target Start/End: Complemental strand, 36314039 - 36313954
Alignment:
366 tagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||| |||| || ||||||||||| ||| |||||||||||  ||| ||||| || ||||||||||| ||||| ||| ||||||    
36314039 tagctcagttggtagggatattgcatattatttgcaggggccggagttcgaaccccgaacaccccacttctccacattataatgtg 36313954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 49251455 - 49251394
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||| || |||| ||||| | |||||||||||||| ||||||| ||||||||||    
49251455 tatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataatgtgaatt 49251394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 50199536 - 50199487
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| |||| ||||| |||||||||||||||| ||||||    
50199536 tatatgcaggggccggggttcgaaccccggacaccccacttattcacctt 50199487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 1151761 - 1151837
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| ||||| |||| |||| | || ||||| ||||||| ||||||    
1151761 cgtgagcttagctcagttggtagggatattgcatattatatacaggagccgggattcgaaccccggacactccactt 1151837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 6702578 - 6702654
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| | ||||| ||||||    
6702578 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccactt 6702654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 477
Target Start/End: Original strand, 9527424 - 9527543
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | |||||  | ||||||||||| || ||||||||||  ||||||||||||||| || |||| || ||||| ||    
9527424 cgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattcatcttataaggtgaa-tt 9527522  T
457 ctatccactatactacttgac 477  Q
    ||| |||||| ||||| ||||    
9527523 ctagccactagactacctgac 9527543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 10851824 - 10851908
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||||||||| |  ||||||| ||| |||||||||||| || |||| ||||| | || || |||||| |||||    
10851824 ctcgtgagcttagctcaattggtaaggatattgtatattatatgcaggggacggggttcgaaccccagaaactccacttctccac 10851908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 12374581 - 12374506
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||| |||| || |||||||| ||||||||||| |||||||| ||| || |||| ||||| ||||||||||||||    
12374581 cgtgagtttagttcgattggcagagatattgcatattatatgcaagggtcggggttcgaacc-cggacaccccactt 12374506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 26584814 - 26584738
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| || |||| ||||||    
26584814 cgtgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt 26584738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 434
Target Start/End: Complemental strand, 34750457 - 34750382
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||| || ||||||||| || ||||||||||||| |||||| ||||||  |||||||||  |||||||||||||    
34750457 cgtgagcataactcaattggtagggatattgcataatttatgca-gggccgatgtttgaaccctggacaccccactt 34750382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 394 - 487
Target Start/End: Original strand, 43020646 - 43020740
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt--aaaatgtgaatttctatccactatactacttgaccacagaaaag 487  Q
    ||||||||||||  | |||| ||||||||||||||||||| || ||||||  |||||||||| ||||| ||||||  ||||||||| ||| |||||    
43020646 tatatgcaggggttggggttcgaacctcggacaccccactcattcaccttgaaaaatgtgaa-ttctagccactacgctacttgacaacaaaaaag 43020740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 431
Target Start/End: Complemental strand, 49503217 - 49503145
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacacccca 431  Q
    |||||| ||||||||||||||| || ||| |||||| |||||||||||||  ||| ||||  |||||||||||    
49503217 gtgagcatagctcaattggcagggacattacataatttatgcaggggccggagttcgaacgccggacacccca 49503145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 359 - 434
Target Start/End: Original strand, 6213424 - 6213499
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||| |||||||||||||| || ||||||||||| ||||| |||||| |  |||||||| | |||| |||||||||    
6213424 gtgaacttagctcaattggtagggatattgcatattatatacaggggtcagggtttgaatcccggataccccactt 6213499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 357 - 440
Target Start/End: Complemental strand, 6712178 - 6712095
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||||| |||| ||  |||||||||  ||||||||||||||| ||||  |||| ||||||| | |||| |||||    
6712178 tcgtgagcttagctcagttggtaggtatattgcattttatatgcaggggccggggttcaaaccccggacactctacttctccac 6712095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 456
Target Start/End: Original strand, 38021250 - 38021348
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||  || | ||||| || ||||||||||||||  ||| ||||| |||||||||||||||| ||| |||||| ||||||||    
38021250 cgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcactttaaaa-gtgaattt 38021348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 45416219 - 45416164
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| ||||||||||||| |||| ||| | |||||||||||||| |||||    
45416219 attgcataatttatgcaggggccggggttcgaatcccggacaccccacttctccac 45416164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 365 - 440
Target Start/End: Original strand, 50536973 - 50537048
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||| || |||||||||||  ||||||||| |  | |||| |||||||||||||||||||| |||||    
50536973 ttagcttaattggtagggatattgcatataatatgcaggagttggggttcgaacctcggacaccccacttctccac 50537048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 403
Target Start/End: Original strand, 51933510 - 51933553
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcagg 403  Q
    |||||||||||||||||| || ||||||||||| ||||||||||    
51933510 tgagcttagctcaattggtagggatattgcatattatatgcagg 51933553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 353 - 459
Target Start/End: Complemental strand, 52833208 - 52833102
Alignment:
353 agtctcgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||| ||||||| || |||| ||||||| || | ||||| || |||||||||||||| |||| ||||| |||||| |||| |||| ||| |||||| |||    
52833208 agtcccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttattcactttaaaa-gtg 52833110  T
452 aatttcta 459  Q
    ||||||||    
52833109 aatttcta 52833102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 2352633 - 2352551
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||  || ||||||||||| |||||||||| |||| |||| ||| | || |||| |||||| |||||    
2352633 cgtgagcttagctcagttgatagagatattgcatattatatgcaggagccggggttcgaatcccgaacactccacttctccac 2352551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 354 - 432
Target Start/End: Complemental strand, 2997729 - 2997651
Alignment:
354 gtctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||||||||||| ||||| || | || || |||||||||| ||||||||||| | |||| ||||| | ||||||||||    
2997729 gtctcgtgagctttgctcagttagtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccac 2997651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 6130101 - 6130019
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| | || |||| ||||  ||||||| |||||| |||||    
6130101 cgtgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaactccggacactccacttctccac 6130019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8741475 - 8741557
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || || ||| |||||| ||||||||||| | |||| ||||| | |||||||||||| |||||    
8741475 cgtgagcttagttcagttggtagggacattacataatttatgcaggggcaggggttcgaacccctgacaccccacttctccac 8741557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 10664862 - 10664781
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||| | | || |||| ||||| ||||||| |||||| |||||    
10664862 cgtgagcttagctcagttggtagggatattgcatattatatgca-gagtcggggttcgaaccccggacactccacttctccac 10664781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 12404358 - 12404439
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||| |||||||| || ||||||||||| |||||||| |||| | |||| ||||| || ||||||||||| |||||    
12404358 cgtgagattagatcaattggtagggatattgcatattatatgca-gggctggggttcgaaccccgaacaccccacttctccac 12404439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #118
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 15368840 - 15368882
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||||| |||| ||||| ||||||||||||||||    
15368840 tatatgcaggggccggggttcgaaccccggacaccccacttat 15368882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #119
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 408
Target Start/End: Original strand, 15775741 - 15775791
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccg 408  Q
    |||||||||| ||||||||| || ||||||||||| |||||||||| ||||    
15775741 cgtgagcttaactcaattggtagggatattgcatattatatgcaggagccg 15775791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #120
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 17671478 - 17671396
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||| ||||   ||||||||||||||  ||| ||||| ||||||| |||||| |||||    
17671478 cgtgagcttagctcagttggtagggatatcgcatttcatatgcaggggccggagttcgaaccccggacactccacttctccac 17671396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #121
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 440
Target Start/End: Complemental strand, 18512607 - 18512561
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| ||||| |||||||||||||| |||||    
18512607 tatatgcaggggccggggttcgaaccccggacaccccacttctccac 18512561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #122
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 360 - 434
Target Start/End: Complemental strand, 19246722 - 19246649
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||| ||||||| | || |||||||||| ||||||| ||||| ||||  |||| ||||||||||||||    
19246722 tgagcttagcttaattggctgagacattgcataatttatgcagaggccg-ggttccaaccgcggacaccccactt 19246649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #123
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 439
Target Start/End: Complemental strand, 19276017 - 19275935
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||| |||||||||||||||| || ||||||||||||| |||| | ||| ||  ||| ||||||| |||||| ||||| ||||    
19276017 tcgtcagcttagctcaattggtagggatattgcataatttatgtatgggtcgaagttcgaacctcagacacctcacttttcca 19275935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #124
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 23233969 - 23234035
Alignment:
374 ttggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||||||| |||||||||||| || |||| ||||| | ||||||| |||| |||||    
23233969 ttggcagggatattgcatattatatgcaggggtcggggttcgaaccccagacaccctacttctccac 23234035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #125
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25036330 - 25036248
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||||||  | |||||||||| ||||||||||||| | || ||||| || |||||||| || |||||    
25036330 cgtgagtttagctcagttggcaggaacattgcataatttatgcaggggccgggattcgaaccccgaacaccccatttctccac 25036248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #126
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 25041542 - 25041460
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||||||  | |||||||||| ||||||||||||| | || ||||| || |||||||| || |||||    
25041542 cgtgagtttagctcagttggcaggaacattgcataatttatgcaggggccgggattcgaaccccgaacaccccatttctccac 25041460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #127
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 360 - 418
Target Start/End: Original strand, 27818573 - 27818631
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaac 418  Q
    ||||||||||||| |||| || ||||||||||| ||||| || |||||| |||||||||    
27818573 tgagcttagctcagttggtagggatattgcatattatattcatgggccggggtttgaac 27818631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #128
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 28564389 - 28564331
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||| | ||||||||||||  | |||| |||||||||||||||||||| |||||    
28564389 gatattgcagattatatgcaggggttggggttcgaacctcggacaccccacttctccac 28564331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #129
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 397 - 443
Target Start/End: Original strand, 29332322 - 29332368
Alignment:
397 atgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||| |||||| |||||||||| |||||||||||||||| ||||||    
29332322 atgcatgggccggggtttgaaccccggacaccccacttattcacctt 29332368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #130
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 432
Target Start/End: Complemental strand, 31401313 - 31401239
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccac 432  Q
    ||||||||||||||| |||  || || |||||||||| |||||||| |||| ||||  |||| ||||||||||||    
31401313 cgtgagcttagctcagttgatagggacattgcataatttatgcaggagccgaggttcaaaccccggacaccccac 31401239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #131
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 433
Target Start/End: Complemental strand, 31762063 - 31761989
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact 433  Q
    |||||||||||||| ||||||| ||||||||||| |||||  ||||| || |||| ||||  ||||||| |||||    
31762063 gtgagcttagctcagttggcagtgatattgcatattatatttaggggtcgaggttcgaacaccggacactccact 31761989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #132
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 34656463 - 34656381
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||| |||||||| |||  || ||||||||||  ||||||||||||  | |||| ||||||||||||| |||||| |||||    
34656463 cgtgagtttagctcagttgatagagatattgcattttatatgcaggggttggggttcgaacctcggacactccacttctccac 34656381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #133
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 359 - 429
Target Start/End: Complemental strand, 35121116 - 35121046
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc 429  Q
    |||||||||||| | |||| |||||||||||||| || ||||||||   | |||||||||| |||||||||    
35121116 gtgagcttagcttagttggtagcgatattgcatattacatgcagggtttggggtttgaaccccggacaccc 35121046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #134
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 36860624 - 36860682
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||||||||| ||||| |||  ||||| |||||||||||||| |||||    
36860624 gatattgcatattatatgcagaggccggggtccgaaccccggacaccccacttctccac 36860682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #135
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 40375383 - 40375301
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||| |||| || ||||||||||| |||||||||| |||| |||  ||||| ||||||| | |||| |||||    
40375383 cgtgagcatagctcagttggtagggatattgcatattatatgcaggagccggggtacgaaccccggacactctacttctccac 40375301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #136
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 394 - 436
Target Start/End: Original strand, 41182809 - 41182851
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    |||||||||||| || |||||||||| ||||||||||||||||    
41182809 tatatgcaggggtcggggtttgaaccccggacaccccacttat 41182851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #137
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 42831946 - 42832043
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||| ||||||| |||| || || ||||||| || |||||||||||| | ||||  |||| |||||||||||||||| ||||||| || |||||||    
42831946 cgtgagcatagctcagttggtag-gacattgcattattatatgcaggggctggggttcaaaccccggacaccccacttattcaccttataaggtgaatt 42832043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #138
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 45517336 - 45517254
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||| |||| || ||||||||||  ||||| ||||||||| | || ||||| ||||||| |||||| |||||    
45517336 cgtgagcttagttcagttggtagggatattgcattttatatacaggggccgggattggaaccccggacactccacttctccac 45517254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #139
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 357 - 419
Target Start/End: Original strand, 52369598 - 52369660
Alignment:
357 tcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||| |||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||    
52369598 tcgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaacc 52369660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #140
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Original strand, 1721175 - 1721228
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||||||||| | || ||||| |||||||| ||||||| ||||||||||    
1721175 tatatgcaggggccgggtttcgaaccccggacacctcacttattcaccttaaaa 1721228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #141
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 362 - 419
Target Start/End: Original strand, 2556562 - 2556619
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||| |||| || ||||||||||| ||||||||||||| | |||| |||||    
2556562 agcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaacc 2556619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #142
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 2643875 - 2643822
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||| ||| || |||||||||| | |||||||||||||| ||||||||||    
2643875 tatatgcatgggtcggggtttgaaccccagacaccccacttattcaccttaaaa 2643822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #143
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 410 - 447
Target Start/End: Complemental strand, 3046213 - 3046176
Alignment:
410 ggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    |||||||||||| |||||||||||||| ||||||||||    
3046213 ggtttgaacctctgacaccccacttattcaccttaaaa 3046176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #144
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 3341796 - 3341747
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| || | ||||| |||||||||||||||| ||||||    
3341796 tatatgcaggggccggggatcgaaccccggacaccccacttattcacctt 3341747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #145
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Complemental strand, 3694982 - 3694902
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||||| |||| || ||||||||||| |||||| ||| |||| |||| ||| | ||||||| |||||| |||||    
3694982 gtgagcttagctcagttggaagggatattgcatattatatgtaggagccggggttcgaatc-cggacactccacttctccac 3694902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #146
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 479
Target Start/End: Original strand, 9163315 - 9163403
Alignment:
391 taatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttctatccactatactacttgacca 479  Q
    |||||||||||| || ||  |||||||||||||||| | ||||||| || ||| |||||||||| ||||| |||||| ||||| ||||||    
9163315 taatatatgcagaggtcgaagtttgaacctcggacatcacacttattcatcttaaaaatgtgaa-ttctagccactagactacctgacca 9163403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #147
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 391 - 455
Target Start/End: Original strand, 9166562 - 9166627
Alignment:
391 taatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatt 455  Q
    |||||||||||| || ||  |||||||||||||||||| |||| || |||||| ||||||||||||    
9166562 taatatatgcagaggtcggagtttgaacctcggacaccacactaattcaccttaaaaatgtgaatt 9166627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #148
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 9768869 - 9768820
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    |||||||||||| || |||| ||||| |||||||||||||||| ||||||    
9768869 tatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt 9768820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 15774372 - 15774311
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||| ||||| || |||| ||||| |||||||||||||||| ||||||| || |||||||    
15774372 tatatgtaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 15774311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #150
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 19793561 - 19793622
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||||||||||||   || ||||| |||||||||||||||| ||||||| || |||||||    
19793561 tatatgcaggggccggaattcgaaccccggacaccccacttattcaccttataaggtgaatt 19793622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #151
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 382 - 431
Target Start/End: Complemental strand, 23369098 - 23369049
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacacccca 431  Q
    ||||||| ||| ||||||||||||||| |||| ||||| |||||||||||    
23369098 gatattgtatattatatgcaggggccgcggttcgaaccccggacacccca 23369049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #152
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Complemental strand, 23464046 - 23463985
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||||||||| |||| ||||| |||||||||||||| | ||| ||| || |||||||    
23464046 tatatgcaggggccggggttcgaaccccggacaccccacttgttcactttataaggtgaatt 23463985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #153
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 27233990 - 27234071
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||||||| |   |||||||||| ||||||||||||||| |||| ||| | || |||| |||||| |||||    
27233990 gtgagcttagttcaattggtatgaatattgcatattatatgcaggggccggggttcgaatcccgaacactccacttctccac 27234071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #154
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 410 - 455
Target Start/End: Complemental strand, 34560382 - 34560337
Alignment:
410 ggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||| |||||||||||||||||||||| ||||||| || |||||||    
34560382 ggttcgaacctcggacaccccacttattcaccttataaggtgaatt 34560337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #155
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Complemental strand, 34702408 - 34702331
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| |||| ||||| ||||||||||| |||| ||||| |||||||| |||||||    
34702408 tgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacacctcacttat 34702331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 37733790 - 37733851
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    ||||||||| || || |||| ||||| |||||||||||||||| ||||||| || |||||||    
37733790 tatatgcagtggacggggttcgaaccccggacaccccacttattcaccttataaggtgaatt 37733851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 455
Target Start/End: Original strand, 39434653 - 39434714
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatt 455  Q
    |||||| ||| ||||  ||| |||||||||||||||||||||| ||||||| || |||||||    
39434653 tatatgtaggagccgatgttcgaacctcggacaccccacttattcaccttataaggtgaatt 39434714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Complemental strand, 48897185 - 48897104
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    |||||||||| |||| |||| ||  |||||||||| ||||||||||||||  |||| ||||  ||||||| |||||| ||||    
48897185 cgtgagcttaactcatttggtaggaatattgcatattatatgcaggggccagggttcgaacaccggacactccacttctcca 48897104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1787 (Bit Score: 45; Significance: 3e-16; HSPs: 1)
Name: scaffold1787
Description:

Target: scaffold1787; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 434
Target Start/End: Original strand, 402 - 478
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||| |||||||||||||  || ||||||||||| ||||||||||||||| |||| ||||||||||||| ||||||    
402 cgtgaacttagctcaattgatagggatattgcatattatatgcaggggccggggttcgaacctcggacactccactt 478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0121 (Bit Score: 45; Significance: 3e-16; HSPs: 2)
Name: scaffold0121
Description:

Target: scaffold0121; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 11994 - 12078
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||| ||||||||| |||| || ||||||||||| |||||||||| |||| |||||||||| ||||||| |||||| |||||    
11994 ctcgtgaacttagctcagttggtagggatattgcatattatatgcaggagccggggtttgaaccccggacactccacttctccac 12078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0121; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 433
Target Start/End: Original strand, 46528 - 46603
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccact 433  Q
    ||||||||||||||| |||| || ||||||||||| ||||||||||||| | |||| ||||| | ||||| |||||    
46528 cgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccact 46603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0246 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0246
Description:

Target: scaffold0246; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 368 - 451
Target Start/End: Original strand, 24392 - 24475
Alignment:
368 gctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||| ||||||||||||| ||||||||||||| |||| ||||| ||||||| |||||| | ||| || |||||||    
24392 gctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttcacatttaaatgtg 24475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 928 - 846
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
928 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 59785 - 59867
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
59785 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 59867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0809 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0809
Description:

Target: scaffold0809; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 486
Target Start/End: Complemental strand, 4902 - 4775
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaattt 456  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||| | |||| ||| | |||||||||||||||| ||| |||||| ||||||||    
4902 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggcgg-ggttcgaatcccggacaccccacttattcactttaaaa-gtgaattt 4805  T
457 ctatccactatactacttgaccacagaaaa 486  Q
    ||| ||||||  ||||||||||||| ||||    
4804 ctagccactaggctacttgaccacaaaaaa 4775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 358 - 419
Target Start/End: Original strand, 56325 - 56386
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    |||||||||| |||||||||||| ||||||||||| ||||||||||||||| |||| |||||    
56325 cgtgagcttaactcaattggcagggatattgcatattatatgcaggggccggggttcgaacc 56386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1372 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1372
Description:

Target: scaffold1372; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 363 - 434
Target Start/End: Original strand, 1871 - 1942
Alignment:
363 gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||||| |||| || ||||||||||| ||||||||||||||| |||| ||||| ||||||| ||||||    
1871 gcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccactt 1942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0707 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0707
Description:

Target: scaffold0707; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 88 - 6
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| |||| |||||  |||||| |||||| |||||    
88 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccacttctccac 6  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0519 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0519
Description:

Target: scaffold0519; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 434
Target Start/End: Complemental strand, 3028 - 2954
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    ||||||||||||| |||  || || |||||||||| ||||||||||||| |||| ||||| ||||||||||||||    
3028 tgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt 2954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0128 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0128
Description:

Target: scaffold0128; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 17622 - 17704
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| || | |||| ||||| ||||||| |||||| |||||    
17622 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccacttctccac 17704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0028 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0028
Description:

Target: scaffold0028; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 112110 - 112192
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| |||||||||| |||| |||||||| |||||| || |||||| |||||    
112110 cgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggtttgaatctcggatactccacttctccac 112192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 236423 - 236332
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    |||||| |||| ||| |||| || ||||||||||| |||  ||||||| || |||| ||||| |||||||||||||||||||| ||||||||||    
236423 cgtgagattagttcagttggtagggatattgcatattat--gcaggggtcggggttcgaaccccggacaccccacttatccacattaaaatgtg 236332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 451
Target Start/End: Complemental strand, 41715 - 41628
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtg 451  Q
    ||||||||||||||||||||||| || |||||||||| ||||||||      |||| ||||| |||||||||||||| ||||| || |||||||    
41715 cgtgagcttagctcaattggcagggacattgcataatttatgcagg------ggttcgaaccccggacaccccacttctccacgtttaaatgtg 41628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 413
Target Start/End: Complemental strand, 266765 - 266710
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtt 413  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| |||| ||||    
266765 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggtt 266710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 8893 - 8811
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| | ||||||||||||| || ||||||| ||||||| ||| || |||||    
8893 cgtgagcttagctcagttggtagggatattgcatattttatgcaggggccgggggttgaaccccggacactccatttctccac 8811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0308 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0308
Description:

Target: scaffold0308; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 394 - 466
Target Start/End: Original strand, 7111 - 7182
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttctatccacta 466  Q
    ||||||||||||||| |||| ||||| ||||||||||| |||| ||| |||||| ||||||||||| ||||||    
7111 tatatgcaggggccggggttcgaaccccggacaccccatttattcactttaaaa-gtgaatttctagccacta 7182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 28000 - 27916
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||||  |||| || ||||||||||  ||||||||||||||| |||| || || ||||||| |||||| |||||    
28000 ctcgtgagcttagctcggttggtagggatattgcattttatatgcaggggccggggttcgatccccggacactccacttctccac 27916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 36; Significance: 0.00000000007; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 11181 - 11106
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
11181 ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 11106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 365 - 440
Target Start/End: Complemental strand, 21509 - 21434
Alignment:
365 ttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||| |||| || ||||||||||| |||||||||| |||| |||| ||||| ||||||| |||||| |||||    
21509 ttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttctccac 21434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0608 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0608
Description:

Target: scaffold0608; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 8968 - 9050
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| ||||  ||| ||||| |||| || |||||| |||||    
8968 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccacttctccac 9050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0445 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0445
Description:

Target: scaffold0445; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Complemental strand, 4082 - 4000
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || ||||||||||| |||||||||| | || |||| ||||| | ||||| |||||| |||||    
4082 cgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttctccac 4000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0250 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0250
Description:

Target: scaffold0250; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 15007 - 15089
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||| |||| || || |||||||||| |||||||||| | ||||| ||||| |  ||||||||||| |||||    
15007 cgtgagcttagctcagttggtagggacattgcataatttatgcaggggtcatggttcgaaccccaaacaccccacttctccac 15089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0117 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0117
Description:

Target: scaffold0117; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 18523 - 18465
Alignment:
382 gatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| ||||| ||||||||| |||| ||||| |||||||||||||| |||||    
18523 gatattgcatattatatacaggggccggggttcgaaccccggacaccccacttctccac 18465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 34; Significance: 0.000000001; HSPs: 2)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 440
Target Start/End: Complemental strand, 37484 - 37399
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtgg-tttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| |||| || ||||||||||| |||||||||| |||| || ||||||||  |||||| |||||| |||||    
37484 ctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggatttgaaccctggacactccacttctccac 37399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 358 - 439
Target Start/End: Original strand, 23363 - 23443
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatcca 439  Q
    ||||| |||| |||| |||| || ||||||||||| ||||||||| ||||| |||| ||||| ||||||| |||||| ||||    
23363 cgtgaacttaactcagttggtagggatattgcatattatatgcagaggccggggttcgaacc-cggacactccacttctcca 23443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0157 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0157
Description:

Target: scaffold0157; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 440
Target Start/End: Original strand, 15764 - 15848
Alignment:
356 ctcgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||||| |||| |||| || ||||||||||| |||||||||| | || |||| ||||| |||| || |||||| |||||    
15764 ctcgtgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccacttctccac 15848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1709 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold1709
Description:

Target: scaffold1709; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 419
Target Start/End: Original strand, 175 - 234
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||| |||| |  ||||||||||| ||||||||||||||| |||| |||||    
175 tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacc 234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1331 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold1331
Description:

Target: scaffold1331; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 419
Target Start/End: Complemental strand, 146 - 87
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacc 419  Q
    ||||||||||||| |||| |  ||||||||||| ||||||||||||||| |||| |||||    
146 tgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacc 87  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 358 - 436
Target Start/End: Original strand, 25024 - 25103
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||| ||||||| ||||||| || | ||||| || |||||||||||| | |||| ||||| ||||||||||||||||    
25024 cgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttat 25103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0690 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0690
Description:

Target: scaffold0690; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 358 - 440
Target Start/End: Original strand, 3668 - 3750
Alignment:
358 cgtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    |||||||||| |||| |||| || ||||||||||| ||||||||||  ||  |||| ||||| ||||||| |||||| |||||    
3668 cgtgagcttaactcagttggtagggatattgcatattatatgcaggaaccagggttcgaaccccggacactccacttctccac 3750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0460 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0460
Description:

Target: scaffold0460; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 363 - 429
Target Start/End: Complemental strand, 13266 - 13200
Alignment:
363 gcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccc 429  Q
    |||||||||| |||| || ||||||||||| ||||||||||||  | |||| ||||| |||||||||    
13266 gcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccggacaccc 13200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0154 (Bit Score: 31; Significance: 0.00000007; HSPs: 1)
Name: scaffold0154
Description:

Target: scaffold0154; HSP #1
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 362 - 440
Target Start/End: Complemental strand, 28885 - 28807
Alignment:
362 agcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||| |||  || || ||| |||| | ||||||||||||| |||| ||||| |||||||||||||| |||||    
28885 agcttagctcagttgatagggacattacatactttatgcaggggccggggttcgaaccccggacaccccacttctccac 28807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0276 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0276
Description:

Target: scaffold0276; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 440
Target Start/End: Original strand, 1263 - 1344
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccac 440  Q
    ||||||||||||||  ||| ||  |||||||||  |||||| |||||||| ||||  |||||||||||| |||||| |||||    
1263 gtgagcttagctcagctggtaggaatattgcattttatatgtaggggccggggttcaaacctcggacactccacttctccac 1344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0219 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0219
Description:

Target: scaffold0219; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 443
Target Start/End: Complemental strand, 6693 - 6644
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt 443  Q
    ||||||||||||||| |||| ||||| ||||||||||| |||| ||||||    
6693 tatatgcaggggccggggttcgaaccccggacaccccaattattcacctt 6644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0126 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0126
Description:

Target: scaffold0126; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 394 - 447
Target Start/End: Complemental strand, 22909 - 22857
Alignment:
394 tatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaa 447  Q
    ||||||||||||||| |||| |||||  ||||||||||||||| ||||||||||    
22909 tatatgcaggggccg-ggttcgaaccctggacaccccacttattcaccttaaaa 22857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 359 - 459
Target Start/End: Original strand, 12564 - 12664
Alignment:
359 gtgagcttagctcaattggcagcgatattgcataat-atatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaatgtgaatttc 457  Q
    |||||| ||||||| ||||||| || | ||||| || ||||||||||| |  |||| |||||||||| |||||| |||| ||| |||||| |||||||||    
12564 gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttattcactttaaaa-gtgaatttc 12662  T
458 ta 459  Q
    ||    
12663 ta 12664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 476
Target Start/End: Complemental strand, 3341 - 3224
Alignment:
360 tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccacctt-aaaatgtgaatttct 458  Q
    |||||||||||||||| |||  || |||| ||||||||| || ||| || | || ||| | |||||||| ||||||| | |||| |||| | ||||||||    
3341 tgagcttagctcaattagcatggacattgtataatatatacatgggtcgggattcgaatcccggacacctcacttattctccttaaaaaggagaatttct 3242  T
459 atccactatactacttga 476  Q
    | |||||| |||||||||    
3241 agccactaaactacttga 3224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 430 - 475
Target Start/End: Original strand, 55234 - 55279
Alignment:
430 cacttatccaccttaaaatgtgaatttctatccactatactacttg 475  Q
    ||||||| ||| |||||||||||||||||||| ||||| |||||||    
55234 cacttattcactttaaaatgtgaatttctatctactatgctacttg 55279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0043 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0043
Description:

Target: scaffold0043; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 66629 - 66580
Alignment:
385 attgcataatatatgcaggggccgtggtttgaacctcggacaccccactt 434  Q
    |||||||| ||||||||||||||| |||| ||||| |||||||| |||||    
66629 attgcatattatatgcaggggccggggttcgaaccccggacacctcactt 66580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 360 - 436
Target Start/End: Original strand, 419712 - 419789
Alignment:
360 tgagcttagctcaattggca-gcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttat 436  Q
    ||||||||||||| |||| | | |||| || | ||||| ||||||||||| |||| ||||| ||||||||||||||||    
419712 tgagcttagctcatttggtaagggataatgaacaatatgtgcaggggccggggttcgaaccccggacaccccacttat 419789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University