View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_high_12 (Length: 548)
Name: NF9150_high_12
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 25 - 322
Target Start/End: Original strand, 8131882 - 8132179
Alignment:
| Q |
25 |
tgagtatatatactctctcggattttgtatttgtgacctgaattttaatttattttccttgctgggacgaagcatgggagcggtttgatttgccagcgtg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8131882 |
tgagtatatatactctctcggattttgtatttgtgacctgaattttaatttattttccttgctgggacgaagcatgggagcggttggatttgccagcgtg |
8131981 |
T |
 |
| Q |
125 |
gatgatctgacggttaaggaggcttttagtgcaacgtggcgttgattaattggtttgatctagttgcttcgacgtggagatgttaagtgagttaagtgtc |
224 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131982 |
gatgatctgacggttaaggagggtttcagtgcaacgtggcgttgattaattggtttgatctagttgcttcgacgtggagatgttaagtgagttaagtgtc |
8132081 |
T |
 |
| Q |
225 |
actatgtaatggatggacccacatggacgacttggaattttcaagtccaccattgccgtttgtgatacttctgattatgtgacaaggatgatattcat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8132082 |
actatgtaatggatggacccacatggacgacttggaattttcaagtccaccattgccgtttgtgatacttctgattatgtgacaaggatgatattcat |
8132179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 314 - 503
Target Start/End: Original strand, 8133312 - 8133493
Alignment:
| Q |
314 |
gatattcattggttatannnnnnngctttctacgtggaatgatattcattggttatagtcaatgatatttgattaaggtgtcttctctaaatctatgcga |
413 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8133312 |
gatattcattggttatatttttttgctttctacgtggaatgatattcattggttatagtcaatgatatttgattaaggtgtct--------tctatgcga |
8133403 |
T |
 |
| Q |
414 |
attgagggtgtcttagt-aatgtaatttgttatggggtttggtgtgtggatcatactttatttaagattggacgtcagttttttgacttaa |
503 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| | |||| ||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
8133404 |
attgagggtgtcttagtaaatgtaatttgttatggggtttggtgtatcgatcgtactttatttaagatccg-cgtcagtttcttgacttaa |
8133493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University