View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9150_high_28 (Length: 323)

Name: NF9150_high_28
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9150_high_28
NF9150_high_28
[»] chr7 (3 HSPs)
chr7 (14-125)||(48286251-48286362)
chr7 (191-244)||(48286119-48286172)
chr7 (272-304)||(48286064-48286096)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 14 - 125
Target Start/End: Complemental strand, 48286362 - 48286251
Alignment:
14 gtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcatt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48286362 gtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcatt 48286263  T
114 gtgattttgtgt 125  Q
    ||||||||||||    
48286262 gtgattttgtgt 48286251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 191 - 244
Target Start/End: Complemental strand, 48286172 - 48286119
Alignment:
191 agataatgaaaatgttgaatgtgggtggttttagatctaaatcttggattggat 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48286172 agataatgaaaatgttgaatgtgggtggttttagatctaaatcttggattggat 48286119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 272 - 304
Target Start/End: Complemental strand, 48286096 - 48286064
Alignment:
272 gatgaaggttgttcgttgcatgagggataagag 304  Q
    |||||||||||||||||||||||||||||||||    
48286096 gatgaaggttgttcgttgcatgagggataagag 48286064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University