View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9150_high_35 (Length: 227)

Name: NF9150_high_35
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9150_high_35
NF9150_high_35
[»] chr4 (1 HSPs)
chr4 (1-207)||(44001639-44001845)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 44001845 - 44001639
Alignment:
1 ttggttactcaccattagttagtttctacatgaaaataatcactatatttttatattcaatcaattgctcatttgatttttcttcttttgcatttaaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
44001845 ttggttactcaccattagttagtttctacatgaaaataatcactatatttttatattcaattaattgctcatttgatttttcttcttttgcatttaaaaa 44001746  T
101 ttcaactttgcgttggtcctaaaatgaacaatcgattgaagaataaatttagagannnnnnnncttattgtaaggaccatttatatccctttgctcttgt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||    
44001745 ttcaactttgcgttggtcctaaaatgaacaatcgattgaagaataaatttagagatttattttcttattgtaaggaccatttatatccctttgctcttgt 44001646  T
201 gataaaa 207  Q
    |||||||    
44001645 gataaaa 44001639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University