View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_low_58 (Length: 325)
Name: NF9150_low_58
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_low_58 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 8 - 325
Target Start/End: Complemental strand, 673887 - 673576
Alignment:
| Q |
8 |
tggtgttggtagacgaaggtgtgtgtgccattgccacgaaattaaatgcaaagaggttgaaagggatg---gaactgatgctatgcaatgctcctgattt |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
673887 |
tggtgttggtagacgaaggtgtgtgtggcattgccacgaaat-----gcaaagaggttgaaagggatgaatgaactgatgctatgcaatgctcctgattt |
673793 |
T |
|
| Q |
105 |
aaccacatttaggaattatcagtaattaaccaagaaatatttattacaaatacaataccagattttattcatttattattacaaaggagaatgatgacat |
204 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
673792 |
aacaacatttaggaattatcagtaattaaccaagaaatatttattacaaatacaataccagattttatt----tattattacaaaggagaatgatgacat |
673697 |
T |
|
| Q |
205 |
gaaagtctcttctttcactgacgaagaaaatcaaccaaaactttaatgaatcttttagattggtcagtttcaagatcatacatgtaataaacatgatcct |
304 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
673696 |
gaaagtttcttctttcactgacgaagaaaatcaaccaaaactttaatgaatcttttagattggtcagtttcaagatcatacatgtaataaacatgatcct |
673597 |
T |
|
| Q |
305 |
catctttctcttcaaagaatt |
325 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
673596 |
catctttctcttcaaagaatt |
673576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 325
Target Start/End: Original strand, 15233733 - 15233767
Alignment:
| Q |
291 |
ataaacatgatcctcatctttctcttcaaagaatt |
325 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
15233733 |
ataaacatgaccctcatctttctcttcaaagaatt |
15233767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University