View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_low_61 (Length: 323)
Name: NF9150_low_61
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 14 - 125
Target Start/End: Complemental strand, 48286362 - 48286251
Alignment:
| Q |
14 |
gtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286362 |
gtttcgtgttggaagcggtttttgttggatgtttgggtctctataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcatt |
48286263 |
T |
|
| Q |
114 |
gtgattttgtgt |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48286262 |
gtgattttgtgt |
48286251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 191 - 244
Target Start/End: Complemental strand, 48286172 - 48286119
Alignment:
| Q |
191 |
agataatgaaaatgttgaatgtgggtggttttagatctaaatcttggattggat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286172 |
agataatgaaaatgttgaatgtgggtggttttagatctaaatcttggattggat |
48286119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 272 - 304
Target Start/End: Complemental strand, 48286096 - 48286064
Alignment:
| Q |
272 |
gatgaaggttgttcgttgcatgagggataagag |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48286096 |
gatgaaggttgttcgttgcatgagggataagag |
48286064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University