View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_low_75 (Length: 235)
Name: NF9150_low_75
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 35328351 - 35328472
Alignment:
| Q |
18 |
atgactagtttactaaagnnnnnnnngaactgaacgattcgtgtattaacatgtgatcaatcaaattatcagaatgtcaaaataatttagtatgtctgag |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35328351 |
atgactagtttactaaagttttttttgaactgaacgattcgtgtattaacatgtgatcaatcaaattatcagaatgtcaaaataatttagtatgtctgag |
35328450 |
T |
 |
| Q |
118 |
atatctttttgaattattagta |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35328451 |
atatctttttgaattattagta |
35328472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 151 - 222
Target Start/End: Original strand, 35328553 - 35328624
Alignment:
| Q |
151 |
aacctataggctaaacaaacttatgaatttggaacagaattgaaggaacaacaggagtggacattgtctctg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
35328553 |
aacctataggctaaacaaacttatgaatttggaacagaattgaagggacaacaggagtggacattgtttctg |
35328624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University