View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_low_77 (Length: 227)
Name: NF9150_low_77
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 44001845 - 44001639
Alignment:
| Q |
1 |
ttggttactcaccattagttagtttctacatgaaaataatcactatatttttatattcaatcaattgctcatttgatttttcttcttttgcatttaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44001845 |
ttggttactcaccattagttagtttctacatgaaaataatcactatatttttatattcaattaattgctcatttgatttttcttcttttgcatttaaaaa |
44001746 |
T |
|
| Q |
101 |
ttcaactttgcgttggtcctaaaatgaacaatcgattgaagaataaatttagagannnnnnnncttattgtaaggaccatttatatccctttgctcttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44001745 |
ttcaactttgcgttggtcctaaaatgaacaatcgattgaagaataaatttagagatttattttcttattgtaaggaccatttatatccctttgctcttgt |
44001646 |
T |
|
| Q |
201 |
gataaaa |
207 |
Q |
| |
|
||||||| |
|
|
| T |
44001645 |
gataaaa |
44001639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University