View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_low_83 (Length: 221)
Name: NF9150_low_83
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 47377331 - 47377530
Alignment:
| Q |
1 |
ctaaaattattttacatatgaaattctcttcacaaactagttgatcttacacattcttctnnnnnnnntgagtcaataactannnnnnnncaagtagtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
47377331 |
ctaaaattattttacatatgaaattctcttcacaaactagttgatcttacacattcttctaaaaaaaatgagtcaataactattttttttcaagtagtct |
47377430 |
T |
 |
| Q |
101 |
gctcactnnnnnnnn-tcatctttttaaaataaacgagcgggtgttcgagcatggatgcagtacatgactaggtgtggctatcgtcaaaccaaatttctt |
199 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47377431 |
gctcactaaaaaaaaatcatctttttaaaataaacaagcgggtgttcgagcatggatgcagtacatgactaggtgtggctatcgtcaaaccaaatttctt |
47377530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University