View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9150_low_86 (Length: 211)
Name: NF9150_low_86
Description: NF9150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9150_low_86 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 13147529 - 13147705
Alignment:
| Q |
19 |
gaatgtgatgcatttacatcaataattgttgacttcgcatgattaacactaggctttgcattttcaaatcaaacannnnnnngaaattataaatttttac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
13147529 |
gaatgtgatgcatttacatcaataattgttgacttcgcatgattaacactagactttgcattttcaaatgaaacatttttttgaaattataaatttttac |
13147628 |
T |
|
| Q |
119 |
ctcaatgagttcttagacactacctttgacaacatatgattggttagatgaacattttcatttttacaggatacatc |
195 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13147629 |
cttaatgagttcttagacactacttttgacaacatatgattggttagatgaacattttcatttttacaggatacatc |
13147705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University