View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9151_low_10 (Length: 201)
Name: NF9151_low_10
Description: NF9151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9151_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 12 - 182
Target Start/End: Original strand, 20154256 - 20154426
Alignment:
| Q |
12 |
agcagagaaaagggtgatggtgactctagtcacaacacctcaaaacacttcaagatttcacaacacaattcaaagagcaacaaaattaggccttcaactt |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20154256 |
agcagagaaaagtgtgatggtgactctagtcacaacacctcaaaacacttcaagatttcacaacataattcaaagagcaacaaaattaggccttcaactt |
20154355 |
T |
 |
| Q |
112 |
cacctccttgaaatcccatttccatgtcaacaagttcaacttccattagactgtgaaaatctcgacgcttt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20154356 |
cacctccttgaaatcccatttccatgtcaacaagttcaacttccattagactgcgaaaatctcgacgcttt |
20154426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University