View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9151_low_4 (Length: 393)
Name: NF9151_low_4
Description: NF9151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9151_low_4 |
 |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 6e-47; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 4449389 - 4449508
Alignment:
| Q |
17 |
actattcaaccattactgagataa-gtttcaatgacatagaagaatatgtgatgctacaagaaaactcttgcaaagataataaagactttcattatcttg |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||| |
|
|
| T |
4449389 |
actattcaaccattactgagataatgtttcaatgacatagaagaatatgtgatgctacaagaaaactcttgcaaagagaataaagaatttcattattttg |
4449488 |
T |
 |
| Q |
116 |
aagtcattctatactttttg |
135 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
4449489 |
aagccattctatactttttg |
4449508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 196 - 370
Target Start/End: Original strand, 4449635 - 4449810
Alignment:
| Q |
196 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctgannnnnnnnnnnnnnngt-ttcaatctaat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| |
|
|
| T |
4449635 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctgatttcatattttttttttcttcaatttaat |
4449734 |
T |
 |
| Q |
295 |
atatgattcttnnnnnnnctgctaacaaatacgaatgaattgggtttgggcttatacaatccggcccgttaaaaac |
370 |
Q |
| |
|
|||| |||||| ||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4449735 |
atatcattcttaaagaaactgctaataaataagaatgaattgggtttgggcttatacaattcggcccgttaaaaac |
4449810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 9826456 - 9826527
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9826456 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
9826527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 31279279 - 31279350
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31279279 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
31279350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 9812060 - 9812131
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9812060 |
ttatcagagcctggttttaatccagggacctatgggttatgggcccaccacgcttccgctgcgccactctga |
9812131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 132 - 185
Target Start/End: Original strand, 4449553 - 4449606
Alignment:
| Q |
132 |
tttggtgcataagtatgtccgaaatgagacgcgataattgtttgccgtttaata |
185 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4449553 |
tttggtgcataagtttgtccgaaatgagacgcgataattgtttgccgttcaata |
4449606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 195 - 264
Target Start/End: Original strand, 9751437 - 9751505
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactct |
264 |
Q |
| |
|
|||| |||| ||| |||||||||||||| ||||| ||||| | |||||||||||||| |||||||||||| |
|
|
| T |
9751437 |
ttattagagtctgatttcgatccagggatctgtgagttatagacccaccacgcttcc-ctgcgccactct |
9751505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 72; Significance: 1e-32; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 24977772 - 24977843
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24977772 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
24977843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 12770774 - 12770845
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12770774 |
ttatcagagcctggtttcaatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
12770845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 24976341 - 24976412
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24976341 |
ttatcaaagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
24976412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 196 - 266
Target Start/End: Original strand, 12766760 - 12766830
Alignment:
| Q |
196 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12766760 |
tatcagagcctggtttcgatccagggacctatgggttatgggcccaccatgcttccgctgcgccactctga |
12766830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 196 - 266
Target Start/End: Original strand, 3894855 - 3894925
Alignment:
| Q |
196 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894855 |
tatcagagtctggtttctatccaaggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
3894925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 12800106 - 12800177
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12800106 |
ttattagagcctggtttcgatccagggacctgtaggttatgggcccaccacgcttccgccgcaccactctga |
12800177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 213 - 266
Target Start/End: Original strand, 12777047 - 12777100
Alignment:
| Q |
213 |
gatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12777047 |
gatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
12777100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 40235004 - 40235075
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40235004 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
40235075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 28745642 - 28745713
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28745642 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
28745713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Complemental strand, 39936227 - 39936156
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936227 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
39936156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 1e-32; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Complemental strand, 20204965 - 20204894
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20204965 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
20204894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 24835072 - 24835143
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24835072 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
24835143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 196 - 266
Target Start/End: Original strand, 16724876 - 16724946
Alignment:
| Q |
196 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16724876 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
16724946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 196 - 266
Target Start/End: Original strand, 18177746 - 18177816
Alignment:
| Q |
196 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18177746 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
18177816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 195 - 262
Target Start/End: Complemental strand, 22261808 - 22261741
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccact |
262 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22261808 |
ttatcaaagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccact |
22261741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 195 - 262
Target Start/End: Original strand, 22266691 - 22266758
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccact |
262 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22266691 |
ttatcaaagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccact |
22266758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 196 - 263
Target Start/End: Original strand, 35269852 - 35269919
Alignment:
| Q |
196 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35269852 |
tatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgtgccactc |
35269919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 14106067 - 14106138
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14106067 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
14106138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Complemental strand, 43822116 - 43822045
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43822116 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
43822045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 195 - 266
Target Start/End: Complemental strand, 44909871 - 44909800
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909871 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
44909800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 195 - 266
Target Start/End: Original strand, 5822 - 5893
Alignment:
| Q |
195 |
ttatcagagcctggtttcgatccagggacctgtgggttatgggcccaccacgcttccgctgcgccactctga |
266 |
Q |
| |
|
|||| ||||||| ||||||||||||| |||| |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
5822 |
ttattagagcctagtttcgatccaggaacctatgggttatggacccaccacgcttccgctgcgtcactctga |
5893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University