View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9152_low_11 (Length: 264)
Name: NF9152_low_11
Description: NF9152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9152_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 17 - 130
Target Start/End: Complemental strand, 54928392 - 54928279
Alignment:
| Q |
17 |
agagagtgttattatatgttgagcacgtgttatcacgcgcctaccttttattggttaaaccgttgtaggagttggaagcgcaagctttgttgctcgattt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54928392 |
agagagtgttattatatgttgagcacgtgttatcacgcgcctaccttatattggttaaaccgttgtaggagttggaagcgcaagctttgttgctcgattt |
54928293 |
T |
 |
| Q |
117 |
caatggccgccgcg |
130 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
54928292 |
caatggccgccgcg |
54928279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 155 - 247
Target Start/End: Complemental strand, 54928257 - 54928165
Alignment:
| Q |
155 |
gttcgaattgttgttgtcggtgatgtggtaaactaaactaaactaactctccttactttaatttcgataatcttcgattgttaatataatagt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54928257 |
gttcgaattgttgttgtcggtgatgtggtaaactaaactaaactaactctccttactttaatttcgataatcttcgattgttaatataatagt |
54928165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University