View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9152_low_17 (Length: 218)
Name: NF9152_low_17
Description: NF9152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9152_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 5635919 - 5636119
Alignment:
| Q |
1 |
tgtcattttcttaaaattttataggagctgaactgtctgtgtctggactgtgctaaagttattgaatatttttacacgtgttggtgtcaaatgtcggaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5635919 |
tgtcattttcttaaaattttataggagctgaactgtctgtgtctggactgtgctaaagttattgaaggtttttacacgtgttggtgtcaaatgtcggaca |
5636018 |
T |
 |
| Q |
101 |
ctagacacgctttcaatttgaagcgtcggtgttatagagctaatgttactcaaattcaaaggcatcatgaattttcattatgttagtgtatggtcagtgt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636019 |
ctagacacgctttcaatttgaagtgtcggtgttatagagctaatgttactcaaattcaaaggcatcatgaattttcattatgttagtgtatggtcagtgt |
5636118 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
5636119 |
t |
5636119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University