View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9153_high_8 (Length: 243)

Name: NF9153_high_8
Description: NF9153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9153_high_8
NF9153_high_8
[»] chr5 (1 HSPs)
chr5 (19-127)||(16087701-16087805)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 127
Target Start/End: Original strand, 16087701 - 16087805
Alignment:
19 tctatttgttaatttcatgttaacttgtctcaaacacattttgctcaaaataatagtttaaaaaaccaagatcacaatttgaacggtagaaattttaaaa 118  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| | |||||||| |||||||    
16087701 tctatttgttaatttcacgttaacttgtctcaaacacattttgctcaaaataatagtt--aaaaaccaagatcacaatttg-atggtagaaa-tttaaaa 16087796  T
119 tcaacacaa 127  Q
    |||||||||    
16087797 tcaacacaa 16087805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University