View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9153_low_13 (Length: 297)
Name: NF9153_low_13
Description: NF9153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9153_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 158
Target Start/End: Original strand, 32937284 - 32937424
Alignment:
| Q |
18 |
cattggacctttttaatgagaaatgttatcatgtaaggggtcattggcatcgaataacacaacagatactgtacgcatagccgatcttaagaagagaaga |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32937284 |
cattggagctttttaatgagaaatgttatcatgtaaggggtcattggcatcgaataacacaacagatactgtacgcatagctgatcttaagaagagaaga |
32937383 |
T |
|
| Q |
118 |
tattggtttcctttgatggtatgaattctatttattttttg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32937384 |
tattggtttcctttgatggtatgaattctatttattttttg |
32937424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 233 - 281
Target Start/End: Original strand, 32937608 - 32937656
Alignment:
| Q |
233 |
tatgatagattgtgatttatcaacggttcaacaaatccatataacttgc |
281 |
Q |
| |
|
|||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32937608 |
tatgatggattctgatttatcaactgttcaacaaatccatataacttgc |
32937656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University