View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9153_low_18 (Length: 243)
Name: NF9153_low_18
Description: NF9153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9153_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 127
Target Start/End: Original strand, 16087701 - 16087805
Alignment:
| Q |
19 |
tctatttgttaatttcatgttaacttgtctcaaacacattttgctcaaaataatagtttaaaaaaccaagatcacaatttgaacggtagaaattttaaaa |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
16087701 |
tctatttgttaatttcacgttaacttgtctcaaacacattttgctcaaaataatagtt--aaaaaccaagatcacaatttg-atggtagaaa-tttaaaa |
16087796 |
T |
|
| Q |
119 |
tcaacacaa |
127 |
Q |
| |
|
||||||||| |
|
|
| T |
16087797 |
tcaacacaa |
16087805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University