View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9153_low_6 (Length: 424)
Name: NF9153_low_6
Description: NF9153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9153_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 6e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 89 - 338
Target Start/End: Complemental strand, 18304455 - 18304204
Alignment:
| Q |
89 |
ttccaattcagtaaaaaatctgcaaaacttgatcccttctgtctacccttccaattaagtaaattccacgtttatacaaatttgaaatacggaatatcct |
188 |
Q |
| |
|
|||||||| |||||||| | ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
18304455 |
ttccaattaagtaaaaagtatgcaaaaattgatcccttctgtctacccttccaattaactaaattccacgtttatacaaatttcaaatgcggaatatccg |
18304356 |
T |
|
| Q |
189 |
tttttctattacaaagcaccaaaannnnnnnnnnnnnnnn--gaaggatgtatagcagtgttatttacagtgaaagaaactatcatgaacgcattgcaaa |
286 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18304355 |
tttttctattacaaagcaccaaatttttttaattttttttttgaaggatgtatagcagtgttatttacagtgaaagaaactatcatgaacgcattgcaaa |
18304256 |
T |
|
| Q |
287 |
ataaaaataaaccaatgaaatatcaaacttgtgcataattcattggaagtta |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18304255 |
ataaaaataaaccaatgaaatatcaaacttgtgcataattcatgggaagtta |
18304204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University