View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9156_low_14 (Length: 377)
Name: NF9156_low_14
Description: NF9156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9156_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 3331874 - 3331666
Alignment:
| Q |
18 |
tcaactgctccactttttcaagctatgcctcctcctaattctaatcctaatcttaatcctaatcttctcggtcagatgccttctgataatttctggccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3331874 |
tcaactgctccactttttcaagctatgcatcctcctaattctaatcctaatcttaatcctaatcttctcggtcagatgccttctgataatttctggccaa |
3331775 |
T |
|
| Q |
118 |
ccgggcgttctccgtattgatcatgatgatattattgcaaagctatcattgttgggaacaaatgttgcaagaaggaaggaattggaagctagggaattcg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3331774 |
ccgggcgttctccgtattgatcatgatgacattattgcaaagctatcattgttgggaacaaatgttgcaagaaggaaggaattggaagctagggaattcg |
3331675 |
T |
|
| Q |
218 |
atgatgagg |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
3331674 |
atgatgagg |
3331666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 298 - 370
Target Start/End: Complemental strand, 3331594 - 3331522
Alignment:
| Q |
298 |
ggttctaggtgagttgatgtatgttgaatttgagactgtaattaaattgatgtatccttattagtattatcta |
370 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3331594 |
ggttctaggtgagttgatgtatgctgaatttgagactgtaattaaattgatgtatccttattattattatcta |
3331522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University