View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9156_low_17 (Length: 212)
Name: NF9156_low_17
Description: NF9156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9156_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 51 - 163
Target Start/End: Original strand, 17088172 - 17088285
Alignment:
| Q |
51 |
ggaagctatttatattgacttatgtagaagcaatcgacacttcacgtacattcatatttttgtccacaatgtccatatatctatgaagcactgatactga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17088172 |
ggaagctatttatattgacttatgtagaagcaattgacatttcacgtacattcatatttttgtccacaatgtccatatatctatgaagcactgatactga |
17088271 |
T |
 |
| Q |
151 |
caggg-cacactga |
163 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
17088272 |
cagggacacactga |
17088285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 187
Target Start/End: Complemental strand, 17841686 - 17841631
Alignment:
| Q |
131 |
ctatgaagcactgatactgacagggcacactgatacaccgacacatctaataatttg |
187 |
Q |
| |
|
||||||||||||||||| |||| || ||||||| || |||||||| ||||||||||| |
|
|
| T |
17841686 |
ctatgaagcactgatacggacacgg-acactgacacgccgacacagctaataatttg |
17841631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University