View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9157_low_9 (Length: 239)

Name: NF9157_low_9
Description: NF9157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9157_low_9
NF9157_low_9
[»] chr4 (1 HSPs)
chr4 (23-223)||(4472290-4472491)


Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 23 - 223
Target Start/End: Original strand, 4472290 - 4472491
Alignment:
23 gtatgtgtcactactttataggtggtttataaaacatcaataaagttaggatcataactttagagaacnnnnnnnn-tggaccatgatttgaattggggg 121  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||| |||||||||    
4472290 gtatgtgtcactgctttataggtggtttataaaacatcaataaagttaggatcataactttagagaacaaaaaaaaatggaccatgatttaaattggggg 4472389  T
122 accaattcaaaggttgagaggctagtaaagatagaaaaagacagatggaacagaccaggggagcagttttgttaggccaccggaaaaattatacataaaa 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
4472390 accaattcaaaggttgagaggctagtaaagatagaaaaagacagatggaacagatcaggggagcagttttgttaggccaccggaaaaattatacataaaa 4472489  T
222 ac 223  Q
    ||    
4472490 ac 4472491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University