View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9157_low_9 (Length: 239)
Name: NF9157_low_9
Description: NF9157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9157_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 23 - 223
Target Start/End: Original strand, 4472290 - 4472491
Alignment:
| Q |
23 |
gtatgtgtcactactttataggtggtttataaaacatcaataaagttaggatcataactttagagaacnnnnnnnn-tggaccatgatttgaattggggg |
121 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
4472290 |
gtatgtgtcactgctttataggtggtttataaaacatcaataaagttaggatcataactttagagaacaaaaaaaaatggaccatgatttaaattggggg |
4472389 |
T |
|
| Q |
122 |
accaattcaaaggttgagaggctagtaaagatagaaaaagacagatggaacagaccaggggagcagttttgttaggccaccggaaaaattatacataaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472390 |
accaattcaaaggttgagaggctagtaaagatagaaaaagacagatggaacagatcaggggagcagttttgttaggccaccggaaaaattatacataaaa |
4472489 |
T |
|
| Q |
222 |
ac |
223 |
Q |
| |
|
|| |
|
|
| T |
4472490 |
ac |
4472491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University