View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9158_high_2 (Length: 379)
Name: NF9158_high_2
Description: NF9158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9158_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 330; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 17 - 370
Target Start/End: Original strand, 7438024 - 7438377
Alignment:
| Q |
17 |
attaagtacataggagtaatattttattcatgcatggctagtgttagtgggaaagggattggtatggaaggagggaaacaaggaagtttactgtgtgtga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7438024 |
attaagtacataggagtaatattttattcatgcatggctagtgttagtgtgaaagggattggtgtggaaggagggaaacaaggaagtttactgtgtgtga |
7438123 |
T |
|
| Q |
117 |
cgcatacagcacaaatcaaatgcagctatcattttcacaatatcattatccatgcaattgtaatccatggaaaggccaacgcatccatgtgttgggctaa |
216 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7438124 |
cgcagacaacacaaataaaatgcagctatcattttcacaatatcattatccatgcaattgtaatccatggaaaggccaacgcatccatgtgttgggctaa |
7438223 |
T |
|
| Q |
217 |
taatattgaggcttttatatataaatagagtatatgcattaattatttacgagcaagtaatttagtgtttgaatgatagaaccagttctgaggttgggag |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7438224 |
taatattgaggcttttatatataaatagagtatatgcattaattatttacgagcaagtaatttagtgtttgaatgatagaaccagttctggggttgggag |
7438323 |
T |
|
| Q |
317 |
gcctattatagttgttcttttgattttaggtcgacattctttataagatctgtg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7438324 |
gcctattatagttgttcttttgattttaggtcgacattctttataagatctgtg |
7438377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 67 - 103
Target Start/End: Original strand, 7451452 - 7451488
Alignment:
| Q |
67 |
gaaagggattggtatggaaggagggaaacaaggaagt |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7451452 |
gaaagggattagtatggaaggagggaaacatggaagt |
7451488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University