View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9158_high_4 (Length: 221)
Name: NF9158_high_4
Description: NF9158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9158_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 198
Target Start/End: Complemental strand, 52511196 - 52511011
Alignment:
| Q |
12 |
agaagcagagaacaaaatgagcttaaactgaagatggtccacatatagtgagttagtgacagacagacacaaacaatgagaatactattactgtttatgg |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511196 |
agaagcaaagaacaaaatgagcttaaactgaagatggtccacatatagtgagttagtgacagacagacacaaacaatgagaatactattactgtttatgg |
52511097 |
T |
|
| Q |
112 |
aggattgtttttgttgtaaaggacaagagccaaaaacatatatgtcttctcattggcagagttttagaaatttccgtgtgaaaaggt |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52511096 |
aggattgtttttgttgtaaagaacaagagccaaaaacatatatgtcttgtcattggcagag-tttagaaatttccgtgtgaaaaggt |
52511011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University