View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9161_low_25 (Length: 322)
Name: NF9161_low_25
Description: NF9161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9161_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 5288732 - 5288421
Alignment:
| Q |
1 |
aatattatcttttcacgcttcccatatttatagtcaagcaaaccatatagcttatggcttgccggttataacctttcaatacctatgaatactcactact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5288732 |
aatattatcttttcacgcttcccatatttatagtcaagcaaaccatatagcttatgacttgctggttataacctttcaatacctatgaatactcactact |
5288633 |
T |
 |
| Q |
101 |
tagatcatctgcccccggttgtattaac------tggacggatgtagccaatgtctatttaatcatcatgttcgattgtagttttgacccaacatgcctc |
194 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5288632 |
tagatcatctgcccccggttgcattaaccttttatggacggatgtagccaatgtctatttaatcatcatgttcgattgtagttttgacccaacatgcctc |
5288533 |
T |
 |
| Q |
195 |
aaaaaatcactgtcttcttaggtgatccaatctactgtactcctcaactccatgactaaggtttgaattgtgggcaggacaagggaataaacactaatag |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5288532 |
aaaaaatcactgtcttcttaggtgatccaatctactgtattcctcaactccatgagtaaggtttgaattgtgggcaggacaagggaataaacactaatag |
5288433 |
T |
 |
| Q |
295 |
aaattaaatact |
306 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5288432 |
aaattaaatact |
5288421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University