View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9161_low_30 (Length: 267)
Name: NF9161_low_30
Description: NF9161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9161_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 33 - 201
Target Start/End: Original strand, 22846275 - 22846428
Alignment:
| Q |
33 |
cactcttgaggatcccacaagagttaggagtaggacaagagtattacgaactaagttaaacacaatggtgaaaactaacacaattttcaataataacaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
22846275 |
cactcttgaggatcccacaagagttaggagtaggacaacagtattacgaactaagttcaacacaatggtgaaaactaac---------------aacaaa |
22846359 |
T |
 |
| Q |
133 |
ttgaaaaatcaatctaactagagaaacaccatccaattctatgaactatagaaacaaaactagttctac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22846360 |
ttgaaaaatcaatctaactagagaaacaccatccaattctatgaactatagaaacaaaattagttctac |
22846428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University