View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9161_low_33 (Length: 234)
Name: NF9161_low_33
Description: NF9161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9161_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 3 - 213
Target Start/End: Complemental strand, 45781998 - 45781779
Alignment:
| Q |
3 |
ttgaaattaaagttgttctgtgttgattagaagaactaacgtccgacaagttttgtgcatgtacaagtcaaattnnnnnnnnatacacaagcactccggc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||| |
|
|
| T |
45781998 |
ttgaaattaaagttgttctgtgttgattagaagaactaacgtccgacaagttttgtgtatgtacaagtcaaattggggggg-atacacaagcactctggc |
45781900 |
T |
 |
| Q |
103 |
agttc----------gtatgtgggcataagtgagaagttaagggtataatgcatcgtacattgaatgatgttaaggttactcttttatatgcatcgatgt |
192 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45781899 |
agttcagttaagttcgtatgtgggcataagtgagaagttaagggtataatgcatcgtacattgaatgatgttaaggttactcttttatatgcatcgatgt |
45781800 |
T |
 |
| Q |
193 |
tgggttccatggagttatgga |
213 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45781799 |
tgggttccatggagttatgga |
45781779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University