View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9162_low_23 (Length: 262)
Name: NF9162_low_23
Description: NF9162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9162_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 24065450 - 24065221
Alignment:
| Q |
17 |
aaagaagacaatatattccttaaacaatgattaatttccatctcaccgttttcttcattatgaaattaacattaattgtgacaaaggaggggggataatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24065450 |
aaagaagacaatatattccttaaacaatgattaatttccatctcaccgttttcttcattatgaaattaacattaattgtgacaaaggaggggggataatt |
24065351 |
T |
|
| Q |
117 |
aattggcaagtggttagtaatctttgtgttcatcaaagaatttgctnnnnnnnntaatgtttatcaaagaaattgagtttattattgtaaaataaaatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
24065350 |
aattggcaagtggttagtaatctttgtg-tcaccaaagaatttgctaaaaaaaataatgtttaccaaagaaattgagtttattattgtaaaataaaataa |
24065252 |
T |
|
| Q |
217 |
gtttattgttttaagaaataatttttcttct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24065251 |
gtttattgttttaagaaataatttttcttct |
24065221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University