View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9162_low_35 (Length: 241)
Name: NF9162_low_35
Description: NF9162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9162_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 7950289 - 7950494
Alignment:
| Q |
19 |
ttccagctctaattgtctatgtgtcatttacagcattggttccgacaaagaaggttggagcaacagattgttcgggtgcttgttcaccatttgagatgcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7950289 |
ttccagctctaattgtctatgtgtcatttacagcattggttccgacgaagaaggttggagcaacagattgttcgggtgcttgttcaccatttgagatgcc |
7950388 |
T |
 |
| Q |
119 |
accatgtcgttctagcgattgtcgttgcatccctgtttatctagttggaggttattgtacaaatccatcatctccaactgttatgaagatggttgaggaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7950389 |
accatgtcgttctagcgattgtcgttgcatccctattggactagttgcaggttattgtacatatccatcatctccaactgttatgaagatggttgaggaa |
7950488 |
T |
 |
| Q |
219 |
catcct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
7950489 |
catcct |
7950494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 77 - 224
Target Start/End: Complemental strand, 6786076 - 6785932
Alignment:
| Q |
77 |
agcaacagattgttcgggtgcttgttcaccatttgagatgccaccatgtcgttctagcgattgtcgttgcatccctgtttatctagttggaggttattgt |
176 |
Q |
| |
|
|||| |||| ||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||| || ||| ||||||||| || |
|
|
| T |
6786076 |
agcagcagactgttcgggtatttgttcgccatttgagatgccaccatgtcgctctagcgattgtcgttgcatccctattgcgctaattggaggtttctgc |
6785977 |
T |
 |
| Q |
177 |
acaaatccatcatctccaactgttatgaagatggttgaggaacatcct |
224 |
Q |
| |
|
| ||||||| || || || ||||||||||||| |||||||||||| |
|
|
| T |
6785976 |
ataaatccaatat---catctattatgaagatggtcgaggaacatcct |
6785932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 224
Target Start/End: Complemental strand, 6803171 - 6803090
Alignment:
| Q |
143 |
ttgcatccctgtttatctagttggaggttattgtacaaatccatcatctccaactgttatgaagatggttgaggaacatcct |
224 |
Q |
| |
|
|||||||||| ||| | |||||| |||||| || | || ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6803171 |
ttgcatccctctttttttagttgtaggttactgctcgcatgcatcatccccaactgttatgaagatggttgaggaacatcct |
6803090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University