View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9163_high_11 (Length: 234)
Name: NF9163_high_11
Description: NF9163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9163_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 23179025 - 23178824
Alignment:
| Q |
12 |
gagcagagaggaatatttaaaacaattatgcaagcagtcaataaacaaaagggaggagtatttttcctacatggtcatggtggaactggaaaaactttca |
111 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23179025 |
gagcaaagaggaatatttgaaacaattatgcaagcagtcaacaaccaaaagggaagagtatttttcctacatggtcatggtggaactggaaaaactttca |
23178926 |
T |
 |
| Q |
112 |
tgtggagaactttagcatcagccatacgttctcaatgtcatattgtgttgactgtggcatcaagtggaatagcatcacttttattaccaggaggaagaac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178925 |
tgtggagaactttagcatcagccatacgttctcaacgtcatattgtgttgactgtggcatcaagtggaatagcatcacttttattaccaggaggaagaac |
23178826 |
T |
 |
| Q |
212 |
ag |
213 |
Q |
| |
|
|| |
|
|
| T |
23178825 |
ag |
23178824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University