View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9163_high_12 (Length: 227)
Name: NF9163_high_12
Description: NF9163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9163_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 20071250 - 20071426
Alignment:
| Q |
12 |
tggtgtttattgatttgtacattttgtccaacctttctct--gtgttcttggacggcctctcgctgtatttttgcgatcattttgatgctttcttgagta |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| ||||||||||| ||||||||| | |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
20071250 |
tggtgtttatcgatttgtacattttgtccaacatttctctatgtgttcttggatggcctctcgatttattgttgcgatcattctgatgctttcttgagta |
20071349 |
T |
 |
| Q |
110 |
gtttgcatgtgtagcatgcatgaacgcattctcgaacaagaaatttctagatagagacattccatgtggactgaatcggtt |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20071350 |
gtttgcatgtgtagcat----gaacgcattctcgaacaagaaatttctagctagagacattccatgtggactgaatcggtt |
20071426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University