View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9163_low_30 (Length: 227)
Name: NF9163_low_30
Description: NF9163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9163_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 5 - 211
Target Start/End: Complemental strand, 7709748 - 7709532
Alignment:
| Q |
5 |
gctagctcgtcaactaccgctgtcaatgtcaatgctagagatgcaacaaagcccgctagctcgtcaaataccgctgccgatgtcaatgttaaagatgcaa |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7709748 |
gctagctcgtcaactaccgttgtcaatgtcaatgctagagatgcaacaaagcccgctagctcgtcaaataccgctgccaatgtcaatgttaaagatgcaa |
7709649 |
T |
 |
| Q |
105 |
caacctctaccaataatgttgtataatttgatgtagaatcatt-atatttacatggttttgcttcgaaaatatt---------gttttttaaacaaacac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
7709648 |
caacctctaccaataatgttgtataatttgatgtagaatcattaatatttacatggttttgcttcgaaagtattaatggtataattttataaacaaacac |
7709549 |
T |
 |
| Q |
195 |
attattatttatcaatt |
211 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7709548 |
attattatttatcaatt |
7709532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 4 - 107
Target Start/End: Complemental strand, 7709803 - 7709700
Alignment:
| Q |
4 |
tgctagctcgtcaactaccgctgtcaatgtcaatgctagagatgcaacaaagcccgctagctcgtcaaataccgctgccgatgtcaatgttaaagatgca |
103 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||| ||||||| | |||||||||||||| ||||| || | ||||||||| || ||||||| |
|
|
| T |
7709803 |
tgctagcccgtcaaataccgctgtcaatgtcaatgctagagattcaacaaatctcgctagctcgtcaactaccgttgtcaatgtcaatgctagagatgca |
7709704 |
T |
 |
| Q |
104 |
acaa |
107 |
Q |
| |
|
|||| |
|
|
| T |
7709703 |
acaa |
7709700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 34 - 107
Target Start/End: Complemental strand, 7709827 - 7709754
Alignment:
| Q |
34 |
caatgctagagatgcaacaaagcccgctagctcgtcaaataccgctgccgatgtcaatgttaaagatgcaacaa |
107 |
Q |
| |
|
||||||||||||| ||||| |||| |||||| ||||||||||||||| | ||||||||| || |||| |||||| |
|
|
| T |
7709827 |
caatgctagagattcaacacagcctgctagcccgtcaaataccgctgtcaatgtcaatgctagagattcaacaa |
7709754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University