View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9164_high_26 (Length: 259)

Name: NF9164_high_26
Description: NF9164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9164_high_26
NF9164_high_26
[»] chr5 (1 HSPs)
chr5 (1-259)||(9402510-9402768)


Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 9402768 - 9402510
Alignment:
1 gcgctatgtgtagtattttgatcattactaacatcgaaatatttaggtctgcgtgctcagactggtctagagatggcaaccagatacatgaggtgatatt 100  Q
    |||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| |||| ||||||||||||||||||    
9402768 gcgctacgtgtagtattttgatcattactaatatcgaaatatttaggtttgcgtgctccgactggtctagagatggaaaccggatacatgaggtgatatt 9402669  T
101 tcacatccatacatcataccttaaccaaaatatgtttatatcatgaggccacctgagcagaagccctttgatgaggtttttgttgagcatcatgggacca 200  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||    
9402668 tcacatccatacatcataccttaaccagaatatgtttatatcatgaggccacctgagcagaagacctttgatgaggttgttgttgagcatcatgggacca 9402569  T
201 ataatggctagactttaggatacggttaggccccatcagagaccaagccatactataat 259  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||    
9402568 ataatggctagactttaggatacggttaggccgcatcagagaccaagccatgctataat 9402510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University