View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9164_low_57 (Length: 259)
Name: NF9164_low_57
Description: NF9164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9164_low_57 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 9402768 - 9402510
Alignment:
| Q |
1 |
gcgctatgtgtagtattttgatcattactaacatcgaaatatttaggtctgcgtgctcagactggtctagagatggcaaccagatacatgaggtgatatt |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
9402768 |
gcgctacgtgtagtattttgatcattactaatatcgaaatatttaggtttgcgtgctccgactggtctagagatggaaaccggatacatgaggtgatatt |
9402669 |
T |
|
| Q |
101 |
tcacatccatacatcataccttaaccaaaatatgtttatatcatgaggccacctgagcagaagccctttgatgaggtttttgttgagcatcatgggacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9402668 |
tcacatccatacatcataccttaaccagaatatgtttatatcatgaggccacctgagcagaagacctttgatgaggttgttgttgagcatcatgggacca |
9402569 |
T |
|
| Q |
201 |
ataatggctagactttaggatacggttaggccccatcagagaccaagccatactataat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
9402568 |
ataatggctagactttaggatacggttaggccgcatcagagaccaagccatgctataat |
9402510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University